Protocol Online logo
Top : Molecular Biology : PCR : Bisulfite Conversion Based PCR : Primer Design Rules for Bisulfite Conversion Based PCR

Primer Design Rules for Bisulfite Conversion Based PCR

Author:Long-Cheng Li
Source:Protocol Online
Date Added:Fri May 07 2004
Date Modified:Mon Dec 12 2005

Abstract: Primer design rules for MSP and bisulfite sequencing PCR (BSP).

A. General consideration for primer selection for bisulfite-conversion based PCR methods

    Because the two strands of DNA are no longer complementary after bisulfite modification, strand-specific primers are used for PCR amplification. Usually the sense strand is chosen for primer design. Primers should be designed according to the guidelines described by Clark and colleagues, and under the assumption that all cytosines had been converted to uracil. 

    Important parameters to be considered for selecting PCR primers are the ability of a primer to form a stable duplex with a specific site on the target DNA and no duplex formation with the other primer or no hybridization at any other target sites.

    Despite variations among bisulfite-conversion based methylation mapping methods, they all share the same procedure of modifying DNA with sodium bisulfite as the first step followed by PCR amplification using primers specific for the modified DNA. The following criteria are common to both methylation specific PCR (MSP) and bisulfite genomic sequencing PCR (BSP).

  1. In normal cells, most CpG sites are methylated except those that are within CpG island regions which are defined as DNA stretches at least 200 bp long with a GC content > 50% and an Obs/Exp ratio of CpG dinucleotides > 0.6. More than half of mammalian genes have CpG islands within their 5' regulatory region. In cancer cells or some other situations such as imprinted genes, CpG islands become methylated leading to transcriptional silencing. Thus, for methylation mapping, it is important to focus on CpG island regions.
  2. To discriminate between the bisulfite modified DNA and the unmodified DNA, primers should have an adequate number of "C"s in their sequence.

B. Bisulfite sequencing PCR or restriction PCR.

  1. Primers should not contain any CpG sites within their sequence to avoid discrimination against methylated or unmethylated DNA. If CpG sites are unavoidable in a primer, degenerate bases should be used at the CpG sites to represent the methylated and unmethylated cytosines. That is using a 'Y' to represent 'C' and 'T' in a forward primer, and using a 'R' to represent 'G' and 'A' in a reverse primer.
  2. Primers should have a minimum number of no-CpG 'C's in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's are preferred.
  3. To map as many CpG sites as possible, a primer pair should preferably span a CpG-rich region.

C. Methylation-Specific PCR (MSP)

  1. Primers should contain at least one CpG site within their sequence, and the CpG site should preferably be located at the very 3'-end of their sequence to maximally discriminate between methylated DNA and unmethylated DNA.
  2. Primers should have a minimum number of no-CpG "C" in their sequence to amplify only the bisulfite modified DNA. Primers with more no-CpG 'C's are preferred.
  3. The primer pair for the methylated DNA (M pair) and the pair for the unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, a forward primer for the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer for the U pair must also contain the two CpG sites, although they may differ in length and start position.

Reference

    Li, LC and Dahiya, R. Bioinformatics, 2002; 18(11):1427.

Printer friendly page