Protocols

PCR Detection of Mycoplasmae contaminants

Posted on Monday, December 18, 2006

Description
Here is the relevant source paper that we took, when we designed our primers:

"Detection of mycoplasma contaminations by the polymerase chain reaction" Wirth M, Berthold E, Grashoff M, Pfutzner H, Schubert U, Hauser H. (1994), Cytotechnology 16(2):67-77



Procedure
Since this reference is however too old and it might be difficult to find a copy of the original paper, here are the sequences of the primers and a short protocol for the PCR the way we do it here. The primers are derived from 16s rRNA conserved regions of the most frequent Mycoplasma contaminants and sequences are as follows:

5' primer mix:

CGCCTGAGTAGTACGTTCGC
CGCCTGAGTAGTACGTACGC
TGCCTGAGTAGTACATTCGC
CGCCTGGGTAGTACATTCGC
CGCCTGAGTAGTATGCTCGC
TGCCTGGGTAGTACATTCGC

3' primer mix:

GCGGTGTGTACAAGACCCGA
GCGGTGTGTACAAAACCCGA
GCGGTGTGTACAAACCCCGA

Primers for the 5' and 3' mixes are then mixed together in equimolar ratios. 45 pM of primer mixes are used in a typical 25 microliter reaction.
PCR products to be detected if Mycoplasma species are present are 504-519 bp.

The protocol we use detects Mycoplasma contaminants directly in cells and uses a semi- to confluent culture in 10 cm culture dish. Cells are washed with PBS, then the monolayer is scraped in 1 ml PBS. Depending on cell confluence, you use 1/2 to 1/4 vol. cell suspension and centrifuge briefly (2 min 13000 rpm) to pellet cells for the PCR. Dissolve them then in 500 microliter 1xPCR buffer and add Proteinase K to 100 microgram/ml final. Incubate 1h at 60 degC. Inactivate the Proteinase for 15 min at 95 degC. You take 2 microliter from this solution for your PCR rxns.

PCR is 30 cycles of:

(94C, 30 sec)
(60C, 30 sec)
(68C, 1 min)

Final extension at 68C for 7 min. Cool down. We take normally 5 microliter PCR rxn for agarose gel electrophoresis. A good idea is to have a positive control, which can be prepared from a culture contaminated for sure. This PCR normally gives no false negatives.

Good luck and let me know if you have any questions.

Recipes


Supplies


Tips
Important is to test the culture after 1-2 passages and not immediately after thawing the frozen stock, because in many cases Mycoplasmas need at least one pasage to show up.

Submitted by: Nexins