Please please help me! - (Jun/28/2008 )

Can someone please help me with these questions!???? Thanks!

1. In the Central Dogma of molecular biology, there are three steps in which genetic information is passed from one molecule to the next: replication (DNA to DNA), transcription (DNA to RNA) and translation (RNA to protein). All three of these processes use one related chemical mechanism for transferring the information. Explain what simple, basic chemical identification mechanism is used for information transfer in all 3 processes (DNA replication, transcription, and translation).


2. The current Phoenix Mars Mission will test for life by vaporizing at very high temperatures organic materials possibly present in soil. An instrument will test for gases such as carbon dioxide (CO2) that are generated. What chemical class of biological material found in living organisms is likely to be converted to CO2 in this experiment?


3. A published research paper that claims to have studied the transmission of large feet in Pueblo Indians would represent what scientific discipline?
a. Molecular biology
b. Mendelian genetics
c. Footology
d. Eugenics
e. All of the above ___B________

4. An application that meets the 3 essential criteria for patentability – novelty, un-obviousness, and utility - will always be awarded a patent.

______X_______True _______________False

5. Splicing is the process that does which of the following?
a. Removes introns and conserves exons
b. Removes exons and conserves introns
c. Removes mutated regions of primary transcript RNA
d. Adds multiple adenosine bases to the end of a primary RNA transcript
e. None of the above _______A_______

6. Proteins are:
a. Always enzymes
b. Linear chains of nucleotides
c. Branched chains of amino acids
d. Always quaternary
e. None of the above _____C___________

7. Which of the naturally occurring amino acids known to be genetically encoded are considered rare? _____ Proteinogenic _____

8. Below is a partial mRNA sequence. Assume the ribosome attaches just upstream from this sequence. If the guanine indicated by the underline is deleted, the number of amino acids in the resulting polypeptide chain will be 6.

5’UUUAUGCAUACGAGAGGGUAGCGAC
True__________________ False_______________________

9. A cross is made between a blue and red strain of cabbage, each having one allele for color. The offspring are all green. When the offspring are crossed, the progeny are 229 blue, 476 green, and 234 red cabbage plants. This is an example of ______________________

10. Which of the following is not characteristic of eukaryotic DNA transcription?
a. Multiple RNA polymerases
b. TATA-binding protein
c. Strict promoter sequence locations
d. Transcription factors
e. Enhancers ______C__________

11. The presence of circular DNA and division by binary fission argue that mitochondria did not originate from prokaryotes.

True_______________________ False___________X_________

12. How do the large and small subunits of a ribosome come together during translation?
a. Self-assembly
b. Translation factors assistance
c. ATP hydrolysis
d. tRNA insertion
e. All of the above ______D__________

13. A peptide is likely to have no more than ___________________ physical structures.

14. Base sequence is a primary determinant of where transcription will terminate.

True____________________ False_______X_________________

15. Write an essay and clearly present two reasons why we should consider viruses as living organisms and two reasons why we should not.

thanks

footology! great

but whats number one? hydrogen bonds?

..."to establish a chemical equilibrium" thats the answer to every question in all fields of science.