iGoogle Bioinformatic Gadgets - A suite of essential bioinformatic tools for any molecular biologist. (Jun/03/2008 )
Hi All!
We have released a suite of bioinformatic gadgets which, we hope, will be useful to the science community. We would appreciate any feedback and hope that you all find it useful.
You can add a Tab to your iGoogle Homepage by clicking here or on the google button here:
Alternatively you can add individual modules which are posted below.
Cheers,
The Team @ http://www.yourlabdata.com/
PubMed / NCBI Search 
Get a simple PubMed searchbox on your homepage.
Reverse Complement 
Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand.
Melting Temperature ™ calculator 
This tool will calculate the melting temperature for an oligonucleotide.
Sequence Manipulation 
Use this small gadget to manipulate sequences to remove non-coding characters, to get the reverse and complement strands, to obtain both strands, to calculate G+C content and nucleotide composition, or convert sequences to RNA.
In Silico PCR Amplification 
Simulation of PCR amplification. Allows one mismatch between primer and template.
Microsatellite Repeats Finder 
This tool finds microsatellites in DNA sequences. Microsatellites are copies ofsimple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.
Protein to DNA 
Enter a protein sequence and obtain its reverse translation. Useful in design of degenerate oligonucleotides. All genetic codes are available.
Primer3 
Primer3 is a widely used program for designing PCR primers (PCR = Polymerase Chain Reaction). PCR is an essential and ubiquitous tool in genetics and molecular biology. Primer3 can also design hybridization probes and sequencing primers. This is a basic edition with only basic input. A full featured edition is comming soon.
Restriction Digest of DNA 
Restriction digestion of DNA sequences with endonucleases. Allows restriction of one or more sequences, and also the comparison of restriction patterns. All commercially available restriction enzymes are included as of REBASE version 711. This service recognizes 253 different cleavage patterns (from all 624 commercially available endonucleases).
This gadget is able to translate DNA sequences to protein sequences by using all genetic codes, including customised ones. All frames are translated.
Palindromic Sequence Finder 
This gadget will search the selected sequence to find palindromic subsequences. It allows selection of minimum and maximum sizes of palindromic subsequences.