PCR of AT-rich DNA - (Nov/15/2007 )

Dear community members,

I want my students to amplify (and later on clone) several genes from lactic acid bacteria. These organisms have a low GC content. Especially the regions downstream of the genes I want to clone are very AT rich.

Of course, this poses problems in the design of the PCR primers. It is difficult to find regions containing sufficient G's and C's to be able to design primers with a GC content that is within the range that many sources recommend for good PCR primers, i.e. say 35 tot 55% GC.

My solution to this problem is to design longer primers (to get a satisfactory Tm) that at least contain one G or C at the 3' end. This resulted in primers like this:

ttctactaactcttttttatttttag (Tm approx. 60 degrees, GC%=20)

or e.g.

tcgtatgaaatgattatttattttc (Tm approx. 60 degrees, GC%=20)

Does any one have experience in amplyfing AT-rich DNA? If so, what do you think of my solution? Am I doing it right or would you suggest to look harder for a region with a higher GC content to prevent aspecific reactions?

Maybe I could find a region with a higher GC% farther downstream, but I prefer the region I have chosen now, because I know there are no sequence differences between strains in that region and I want to PCR the genes from several strains. I'm afraid that there will be sequence differences between strains in the region farther downstream, which could result in no primer annealing.

The obvious solution is to just try it and order new primers if it doesn't work. However, this is a student project and the amount of time they have is limited. Therefore, I want to use the strategy with the highest chance of success.

Thanks very much,
Peter

I routinely work with a 26% GC organism, with regions < 15%. You should easily be able to get these primers to work. The major issue is to use lower than normal extension temperatures (64-66) and correspondingly higher extension times. See PMID: 8628694
I agree with your primer design strategy.

Your strategy sounds fine. The main issue is having a Tm high enough that the primer stays on at the polymerase's active temp (usually ~65C).

If you're looking for the complete gene, you have to select primers that allow this (which is what you seem to have done). IF you want to try to differentiate between strains, then having one primer from a strain-specific region could be beneficial (although you will then need to have some pretty good controls to show the expt worked as desired).

Going for the simplest solution, I think you're on the right track.

Thank you for your remarks. It is encouraging to know that two 'veterans' feel that we're on the right track! I will try to remember to let you know if we succeed!

Peter