Controls for Bisulfite Sequencing - (Feb/05/2007 )

I have been trying to do bisulfite sequencing for several regions of maize DNA but I am not getting any PCR products. The more papers I read, the more research I do and the more trouble shooting I do, the more confused I become.
I have many unanswered questions and I would be really happy if someone could help me out here.

I don't know if the problem is with my primers.
I ordered two sets of primers, the first one is for untreated DNA and the second set is for bisulfite treated DNA that would amplify the very same region. The amplification of my untreated DNA happens beautifully but once I treat my DNA and want to amplify, I don't get anything...I tried to amplify my treated DNA by both sets and have gotten no results....

To find a pair of primer that I knew would work, I found different papers that analyze methylation status of regions on maize DNA.....I looked at the control they used (eg.OPAQUE2 gene)...which is fully menthylated...meaning over 95% of C's in this sequence is menthylated....but when I look at the primers they used to amplify this region, the primer is designed considering all the C's being fully converted to U's....
I don't understand how a primer that is designed based on the conversion of all the C's to U's on the forward and reverse sequence can amplify a piece that is fully methylated, meaning bisulfite treatment can't modify the C's?????

On top of that....why is the control a fully methylated peice??? when the C's are not going to convert to U's how would you know if the bisulfite sequencing has actually occured???? what kind of a control is this???


By the way for the method I used the method listed in another posting by labtechie...



Please help, I really need it....


Thanks, Kam

---

Hi Kam, I hope I can answer some of your questions.


Well, there is good and bad news - the good news first: If after bisulfite treatment your primer for unmodified sequences does not work anymore it means that conversion took place. The bad news: your primer pair for modified sequence does not work.

Okay, there are slight differences between animals and plants regarding the ability to methylate non CpG C's. But generally spoken, even in plants, only C's in the neighbourhood of G's can be methylated. That means that non CpG C's (or similar motifs in plants) should be fully converted by bisulfite, as they are never methylated! You can use this to design primers that bias towards full modificated templates and still get the information on the methylation status of the CpG C's (and I assume that's what they did in the paper)

You normally use full methylated DNA as control to check, if you are getting any C traces for the CpG C's. If not, there may be a problem with the sequencing. Some also use fully demethylated DNA, as an opposite control.

Kam, it may be most helpful if you paste the sequence of interest and also the primers you used so far - we could help you more directly...

But bisulfite sequencing is working on maize and is going to work for you, too.

Krümel

---

there is the added complexity that maize also has non-CpG methylation such as CNG and CNN methylation.

so it would be difficult to determine suitable primers for your PCR amiplification unless you know beforehand the methylation status of your C's.

Having said that, it is entirely possible to have 95% methylation within the amplicon using primers designed to C's that become U's afte bisulfite. it is because in plants, methylation can occur at sites other than CG.

So it would be more challenging to determine if the bisulfite has worked or not in plants.

You may need to confirm via another method such as methylation sensititve restriction digest and southern blotting or PCR.

Good luck

Nivk

---

Ooops, sorry for the confusion. You're right Nick, in plants CpNpG and CpNpN can also show methylation. But wouldn't degenerated primers containing no C's solve the problem?

K.

---

not really krumelmonster, because then there is no selection for converted DNA templates, hence the challenge with studying maize. This is an example where restriction enzyme mediated assays would prove to be an invaluble tool to confirm your bisulfite sequencing results.

Nick

---

Thank you for all your replies but here is where I got lost:

The Following paper:

Rossi V, Motto M, Pellegrini L. Analysis of the methylation pattern of the maize opaque-2 (O2) promoter and in vitro binding studies indicate that the O2 B-Zip protein and other endosperm factors can bind to methylated target sequences. J Biol Chem. 1997 May 23;272(21):13758-65.

Showed methylation status of opaque2 gene…the attachment shows the methylation map…in figure B (leaf)…they used almost all the C’s regardless of CpG context or not are methylated.


Okay Now, this second paper:

Gutierrez-Marcos JF, Costa LM, Dal Pra M, Scholten S, Kranz E, Perez P, Dickinson HG. Epigenetic asymmetry of imprinted genes in plant gametes. Nat Genet. 2006 Aug;38(8):876-8. Epub 2006 Jul 2.

used the above studied sequence as their control (in their methylation study of fie1 and fie2 genes) with the following primer pairs:

opaque2
Primers to be used after bisulfite treatment
Forward GTAATTATTAATTAATGGTTTTAAGYAAAGGTT
Reverse ACATAAACCTCAAAATTATATAAATAAAACAA

Primers to be used before bisulfite treatment
Forward GTAACTATCAATCAATGGTTCCAAGCAAAGGTCReverse ACATGAACCTCAAAGTTGTGTAGGTAGAACAG

GTAACTATCAATCAATGGTTCCAAGCAAAGGTCAAGGAAGGGAGAAGCAAACACTAGGAATTGAA
GGAGATGCAGTGCAAGGGGAGGGACCCATAGATATGATGGGTCGTCGGCGGCATATCTCTATGCACCCAT
GAGTTAATTATGTTAGCTGCTTGAAGGAGATCGAGGAGTACGCTTGGATGCTCTTCTTTCCCCCCCTACT
TATCTAGTGCTGGGCTCTCTCTCTTGCTGTGCCTCCCTGCAGAAACTTCTGGAGAGGCAAAAAAAAAGAA
GAAAAAAATGCATCGGCCTTGCACTCAATGTGAACCTGCAGGGCAGCAAATAGGACAAGTGATTTTGTTT
GGAAAGGCTAACAGAAAGCAAAGTTAGCTAGATGGTGCGCTACCAAGTTACGTACCATGGGTTTTATCGT
GACGCTACATGCATGTGTGTTTTTGTTTTAACCACACGTGTTAGCAATAAGCCAAGCGTGTACCCATGCA
TGCCCGTGTGTGTTCTACTACCTTTAAACCACTGGATTGGATAACGAGTTTTGCACTGGCTTTGTGTGCT
AGACACCATGCCTTACCAACGTCAACATGTATTGTATTGCACTTTCTGTTCTACCTACACAACTTTGAGG
TTCATGT

But if you look carefully you will see that both forward and the reverse primers (for treated DNA) are designed assuming that out of CpG context C’s would convert to U’s…..completely disregarding the fact that the all these C’s are methylated and will not be converted to U’s in the first place…..So how in the world could they use these primers to amplify the treated sequence?

Thanks, Kamelia

---

You're right, Kamelia, that is confusing
and it gets even murkier. In the first paper you have mentioned, it seems that they also used PCR primers designed to amplify only fully converted template - disregarding the fact that in the primer sequences some C's are incoporated. This sheds some doubts on the whole story, as they pick those templates that were (by random?) unmethylated in the binding sites and showed (again by random?) a lot of methylation of all C's in the rest of the sequence
What I find even more confusing in the paper is, that they use artificially methylated plasmid products (the same promoter fragment) to control for sufficient conversion. But they use Sss1 for methylation, which only methylates CpG C's. So it is no wonder, that in their controls, bisulfite modification works rather good...
Nick, can you explain it? Are we missing something? Or is this really a systematic error in the study? Would be interesting to know if the JBC accepts letters to the editor dealing with methodological issues of ten-year old papers

K.

---

Does anyone know where I can buy plant unmethylated DNA???

---

Krumel,

I can't explain it, but to say it seems rather fishy. I can see how it would be easy t o select clones for publication, in our hands a truly imprinted loci would give 50:50 methylated:unmethylated clones on a very good day, most times it deviates from this even though other methods suggest that it is imprinted.

I am always a little suspicious when there are perfect 50:50 clone methylation patters published in high ranked journals as you righty point out Krumel, how random are the clones?

The SssI methylase experiemnt doesnt make sense.

as for unmethylated plant DNA, I would suggest using a WGA protocol on plant DNA as this would yield unmethylated DNA

Nick

---

@Nick - that fit my thoughts exactly - bitter, that a study like this makes it inot Nature Genetics...

@epigenetics - I second Nick about WGA. Another possibility, depending on your question, would be to amplify a larger fragment of your gene that incorporates your locus of interest. After PCR the DNA is free o methylation.

K.

---