Bisulfte PCR and sequencing PCR and Primer Notes - Tips and hints on PCR for bisulfite converted DNA and bisulfite primer (Jan/08/2007 )

Thank you for the quick response!

What do you mean by hemi-nested? I would suspect you continue using one primer from the first round and only change the second one? Does it matter whether you keep the forward or reverse primer?

And the PCR Program from your friends protocol: It's split into 2 parts with the difference being the extension time. The split is only made to save time, seen as after initial synthethis of complementary strands a shorter time is sufficient? Are there other reasons?

I have been using M13 tailed primers, would that be a viable approach in your opinion or would you consider SP6 and T7 superior? I have been running into quite a lot of problems with the M13 primers, instead of getting a band on my gel, i get a whole glowing lane...

All primers were established before I entered the project and with the current results, I'm seriously considering making completely new ones and starting all over again. Already got Methprimer Express, seems pretty cool so far.

Thanks again for having my questions!

Hi Cyburn,

sorry for the late reply.

you have the theory of hemi-nested strategy right. doesn't matter which primer forward or reverse you select.

The two steps in the cycling are not to save time but to ensure that the template is copied properly in the initial PCR cycles because bisulfite PCR is a strand specific PCR and in the initial cycles, only one primer can recognise the template sequences, it's only when you have the template copied, that the reverse primer recognition sequence is generated. The increased extension step just allows for that to happen.

I haven't used M13 so I can't comment on your tailed primers, we have been using SP6 and T7 because we have plently of it around.

I have found that with my work initially and of many others I have come across, primer design is the major issue!


good luck
Nick

Dear Nick,

Aftre the second round of nested PCR I got a smear. Now as I know smear is coming from degraded DNA. But if I'm doing my PCR with the controll primers, I got a nice band with exact size so I wouldn't think it is DNA degradation. I repeated the PCR, with a mixture of the dilution of the second round product and the diluted first round product as a temlpate but now I didn't get any result :-(
In many cases I see the primer dimers (if those are primer dimers) on the bottom of the gel/ladder. At least today I didn't see it - but now I really cannot explain my results and don't know how to go on. Do you think I can achieve any information from that if I see these dimers or not? Can I say that if I see them the conditions were set wrong and when I don't see them, there must be some products but maybe too small amount of DNa to visualize? Or there is no correlation like this?
J.

Hi J.,

it would be easier if you share primer sequences, target sequence and PCR conditions. Then we might help you more efficiently.

K.

Is there a max size for tailed primers? I would like to use a 30mer as complementary part and add a 15bp sequence (M13) to it, making it a whopping 45mer. Would that be possible?

My longest experience was 42mer - no problem.
Krümel

Dear Methylnick,
I am a newer,your comments are very helpfulT,hank you very much!
Here are my questions :which software dou you use to design nested or hemi-nested primer for BSP?Until now ,i haven't found a tool to design nested primers for BSP. Could you drop a few lines to design nested PCR primers for BSP ?Expecting your answer,thank you!

hi xry05,

in short, I don't use a program to design my nested primer sets, I pick them by eye.

Methylprimer express is the one that picks the better primers in my eyes compared to methprimer. To pick nested primers, you can use the program and force it to pick a primer within a certain region but this is sequence specific and may work for some and not for others.

I use the primer notes from earlier in this thread to pick my primers by eye.

Nick

If you want to use software, you can pick the primers for the first round with MPE, than you use the sequence of the amplicon to pick primers with Primer3 (or any other "ordinary" primer tool). You have to play around with the settings to make sure you have no CpG-C's in the primer binding sites. But I would also suggest to pick them by eye following Nick's suggestions in this thread.

Dear Methylnick and krümelmonster:
Thank you for the fast reply. I don't have any experience on BSP,here are my primers designed by Mrthprimer Expression,and i choose this pair:(BSP)
Left : 5’GATTTAGTTTGGTGTTGAGTTTTTT 3’
Right: 5’ACATAAAAATATATATCCCAATTCC 3’,
i don't konw if it is the best primer.can you help me to design the nested primer?Thank you !