Nanodrop question - Spectrophotometrical measurment of bisulfite treated DNA (Nov/30/2006 )
Hello, I am new here. Recently I started epigenetic study. I used DNA extracted from brain (just frozen ). For extraction I used QIAamp mini kit (tissue protocol). I've got nice results (260/280 around 1.80 260/230 >1.6 and average yield was around 35 ng/uL eluted in 100 uL of AE buffer). Afterwards I purchased QIAGEN epitect kit for bisulfite conversion. I tried conversion of 20 uL of DNA. However after epitect procedure, spectrophotometrical measurements (nanodrop 1000) indicated huge peak at 230 nm (with no peak on 260) and inconsistent concentration readings (much higher than starting concentration), and I couldn't get any results from PCR with primer set that had been reported elsewhere (expected product size is 503 bp). What are expected spectrophotometrical readings of bisulfite treated DNA?
One more question, can anybody share with me sequence of some validated primer set with PCR condition that I can use as positive control for PCR of bisulfite treated DNA 
Thanks
Hi Branco,
your spectrometric problem is rather common as bisulfite treated DNA can not be quantified by spectrometry. It is a single stranded mixture of nucleic acids that has features of DNA and RNA.
A 503bp long fragment is rather large for the beginning. What cycle conditions did you use? You should have long annealing as well as elongation times, and you normally need to do a nested PCR to get visible bands.
In the pinned threats above you can find a PCR protocol by Methylnick, it works really well with almost all of my primers!
Good luck,
Krümel
Thanks for a tip Krümel. Actually I used standard PCR protocol from my lab.
95 C for 8 mins
45 cycles 95 C for 40 sec, 50 C for 40 sec and 72 for 1 min
final extension 72 C for 7 mins
Primers forward GTATTTTTTTAGGAAAAATAGGGTATATTGA
reverse ACTCCCAAAATTACTTTAAACC
I wanted to do a promoter screening for methylation status by bisulfite sequencing.
I just checked Methylnick's cycling condition and I realized that my annealing and extension time is too short .
Hi Branco,
I've seen that you used a huge number of cycles. I would definitely suggest using a (hemi-)nested strategy. Do you plan to do direct sequencing or are you going to clone and sequence? If you do it directly, I had success with the method described by Han et al (PubmedID: 16797472) using C/G enriched second round primers. Another important issue mentioned in many threats is the correct annealing temperature. I use 65° for annealing in the second round PCR!
Much luck and don't let funny sequence readings get you down 
Krümel
PS: How did you pick your primers? By eye or in silicio?
Hello again,
Since this was just test run (I wanted to get familiar with protocol), primers were picked from article (PMID: 15717292), and it was direct sequencing strategy (and still is ). If you don't mind, just three more questions, you mentioned to correct annealing temperature for 2nd round PCR, was that 2nd round nested PCR? And if it is so, should I always use 65 C? Also regarding nested PCR, how many uL should I pick from 1st round PCR to serve as template for 2nd round?
Thanks again. 
Hi Branco,
You're right, I ment 2. round of the nested PCR. If your cycler supports temperature gradients (which mine doesn't), you can do one for the annealing temperature (e.g. 65-72°C). But for me, several primers are working very well at 65°.
I routinely use 2µl of the round one product. It is not necessary to perform any purification steps between both rounds.
I normally do a gel run of the second round PCR mixture, cut out the band and clean up the DNA fragment for sequencing.
If you are getting sequencing results, don't worry if the forward primer is not producing any results. This is often the case!
Bon courage!
K.
PS I have just seen, that you are going for reelin - that one was tricky for me. I use the same primers like you for the first round, but CG enriched primers for the second round.
Thanks for the advices.
Branco
Hi Branco,
I would like to add my comments,
65C is not a temperature set in stone, it really depends on the calculated annealing temperature of your primers. I typically set the Tm to be 2C below the calculated Tm.
Furthermore, if your primers are for bisulfite PCR and sequencing, I would have to say just on looking at them that they would not be efficient in amplifyikng fully converted DNA and as a result, if you do get amplicons from your PCR they would be a mixed population of converted templates with varying degrees of conversion. That is to say you not only would you see CpG methylation but also non-CpG methylation which would be a spirious result if you are working in mammalian systems.
Primers should end in T's (forward) or A's (reverse) on bases that were C's prior to conversion, this would selectively bias towards fully converted templates as the 3' end of the primers are most discriminatory, so if you have a mismatch there you are far less likely to obtain an amplicon.
good luck!
Nick
Hi Methylnick,
Thanks a lot. By the way, in your opinion, which formula for calculating Tm for primers gives best prediction?
Hi Branco,
I would choose a Tm calculator and stick with it. I use AB's primer express and I think it is using the nearest neighbour method for calculations.
Perlprimer uses the most up do date Tm formula to date and it is pretty accurate in it's Tm calculations.
Nick