MSP for help - (Sep/13/2006 )

I have been working on MSP for two weeks.I followed the protocol which is recommended on this bioforum(Protocol Online Bisulfite Modification (Conversion) of DNA).But It failed include the Sss1 CpG methylase treated DNA.I don`t know what is the problem.My questions are as follows:
1.What is the composition of your Sss1 reaction .My methylase enzyme is purchased from BioLabs.And how to purify thet Sss1 CpG methylase treated DNA.
2.I used a purification kit from TIANGEN company.The 610uL volume is too full to purify because the volume of the column is 800uL.So I used 5M NaCl to bind the DNA and purify it.
Can anyone tell me whether it is feasible？
3. The pH of TE buffer I used is 8.5.Does it matter?
4.Is the pH of sodium bisulfite very important?I have no pH meter and the pH paper doesn`t work well.It is difficult to distinguish pH 5.0 with others.

Thanks!
Leydig

How do you know that the problem is at the modification step in stead of your PCR?

Yes, the pH of sodium bisulfite is important and you need to get it right.

If you can afford it, buy a DNA modification kit from Qiagen.

I use SssI methylase as per typical reaction set up given by NEB, i check with a methyl-sensitive restriction enzyme to make sure it is completly methylated before going on to bisulfite treat. To clean up, i typically perform a phenol/chloroform step and ethanol precipitation to remove the enzyme from the DNA.

pH is uber important in the bisulfite reaction as it determines how much free bisulfite ions are available for conversion.

Nick

PCRMAN and nick,
Thank you very much.I I have solved the problem of methylase enzyme sss1.Now I followed the protocol which is modified by nick.It almost works well .But the PCR is not satisfying.There are always many nonspecific bands on the M lane including the water and the U lane is satisfying.I have repeat the PCR again and again.I have replace the water because I think the water may be polluted. The result remains so. I`d like to show you the pictures and hope you can help me out.
The condition of PCR is as follows:
DNA 2ul
sense primer 1ul
antisense primer 1ul
dNTP 1ul
10*PCR buffer 2.5ul(including 1.5mmol MgCL)
Hotstar Taq(QIAGEN) 1.25unit(0.25ul)
and water 16.25ul
95℃ predenature for 15min,(95℃ denature 30s,60℃ annealing for 30s and 72℃ 30s )*38 cycles,72℃ extention for 5min.
The sequence of the primers is as follows:
M primer:
Sense TGGAGGATTTTTTTGCGTACGC
Antisense CGAACCGAACGCCGCGAA
U primer:
Snese GTTGGAGGATTTTTTTGTGTATGT
Antisense CCCAAACCAAACACCACAAA
The primers are from a article but I modifed the M primer.The original sequence is
Sense TGGAGGATTTTTTTGCGTACGC
Antisense GAACCGAACGCCGCGAA
I just add a "C" at the 5` end of the antisense primer.The sequence is absolutely right.Can you tell me where is the problem of my PCR?
Thanks.



The M2,U2,M4,U4 are annealing at 63℃.The others are annealing at 60℃.

hi leydig,

I am very suspicious with your H2O controls,

looks like your primers are somehow dimerising, or concatamerising, I can't say for sure you have contamination in your reagents because M2 is clear, however, you should try using a fresh aliquot of Taq and try and rule out any possible contamination by using fresh reagents.

Also you could increase your Tm a little, say to 64 and 65, your bands are strong suggesting you have a robust primer pair, and smearing and extra bands in your M lane could suggest mispriming and increasing the temp will alliviate this.

Another thing you should try is to reduce the number of cycles, 38 seems rather excessive and you could be reaching a plateau by having too many cycles, try 20, 25 and 30 cycles and I think this will help also.

Hi,Nick.
Thank you for your good advice.I`m sure there is no contamination with the water and my operation.I changed the M primer. Now I use the M primer as was described in the original article.The PCR results are better than before.Although there are also some nonspecific bands in M lane,they were weaker.Should I elevate the annealing temperatureT or reduce the cycles?
Thanks!

The pictures are as follows:

Leydig,

I would first elevate your Tm between 1-2 degrees, and if the bands are there (should be less intense) I would then lower the number of cycles. (of course this should also be done with your U set so that your assay is consistent)

Nick

Thanks,nick.
I elevated Tm from 59 to 63 degree and the bands are very good.I just complete my experiment today.But to my dispointment,there is no methylation in my interest gene.I have a question .If there are interest bands on both M and U lanes ,what do that mean?Does that mean partial methylation if incomplete decoration is excluded?My DNA is from tumor tissue and the incidence of methylation of the gene is 10-20% as is reported.
Thanks,leydig!

having positive M and U bands could mean a number of things. Your region of interest is imprinted, you conversion was not efficient, you region could be partially methylated or you have a mixed population of cells.


If you are looking at tumor tissue, then I would say it would be likely that you have a mixed population of cells, ie: normal cells mixed in your sample. How certain are you that you have a pure population of tumor tissue and no normal cell contaminiation? as this would be the most likely reason.

Nick

So if there is normal cell contaminiation in the tumor tissue,the simultaneous appearance of both M and U bands can mean the tumor suppressor gene is methylated.Isn`t that right?
Thanks!leydig