Protocol Online logo
Top : Forum Archives: : DNA Methylation, Histone and Chromatin Study

No PCR Product after Bisulfite Modification - (Aug/17/2006 )

Hello I am new to the Forum and this is my first post.

I have been trying to start a project looking at the methylation patterns of CpG islands in promoters. I have been trying to use Qiagen's Epitect Bisulfite kit to do the conversions. I have two sets of primers (from MethPrimer), one for the genomic and one for the BS converted for use in PCR and hopefully sequencing. The genomic set work fine on the unmodified DNA. After the BS treatment however the primers specific for the bisulfite modified DNA are not working. I just get a big smear. The BS primers are simply the converson of the genomic primers so I do not uderstand why they are not working.

Has anyone used this kit before?

Any suggestions for the PCR?

Any help would be appreciated. Thank you.



Try lowering the extension (not annealing) temperature to 63 C instead of 68 or 72 C.


can we have a look at your bisulfite primers?

methprimer doesn't pick very efficient ones.

Phage434, if PCRgal is getting smears with her BSP wouldn't lowering the temperature enhance the smears markedly?



Not necessarily. The full length product might well be robustly inhibited, while some poorly amplifying side products would eventually be amplified. A PCR reaction which is run a sufficient number of cycles will usually amplify something.


I am looking at the promotor region of the Survivn gene. I took my primers from Meth primer here they are

Survivin Genomic
Forward 5’ tggtcttgaactccaggactcaagtg 3’

Reverse 5’ cctccaagaagggccagttcttga 3’

Survivin Bisulfite Modified
Forward 5’ tggttttgaattttaggatttaagtg 3’

Reverse 3’ cctccaaaaaaaaccaattcttaa 3’

Any thoughts


Your primers will be more specific if you have one or two converted bases at the 3' end. That's not to say there is anything inherently wrong with the ones you're using. The conversion is correct.

What are your BSP conditions and how much DNA are you loading? Have you tried a gradiant PCR to see if you obtain a more specific band? BSP often consists of a hemi-nested or fully nested PCR approach consisting of 30+30 cycles to increase specificity. I gather you're using only the one set of primers.