ABI have released MethylPrimer Express! - A new primer design program for DNA methylation....For Free!!! (Jun/02/2006 )
Hi All,
I figure there will be many people interested in this : check out the link:
Methylprimer Express
And please post comments about this program and if it works for you. I would be interested to know. I am on a Mac and the download isn't working for me.
Cheers
Nick
I figure there will be many people interested in this : check out the link:
Methylprimer Express
And please post comments about this program and if it works for you. I would be interested to know. I am on a Mac and the download isn't working for me.
Cheers
Nick
Thanks very much . I have download it and gonna try it.
Hi,nick
I have downloaded and installed the software,but when I put in my pet DNA sequence ,it always says"error 6 en tiempo de ejecucion;Desbordemiento",even the sequence in FASTA format.I think these words are French ,so I don't know what the problem is.
Does it work for you now?If you haven't downloaded the software successfully yet,I'm glad to send it to you by e-mail. 
I have downloaded this software without any problems. I've only had a quick play with it so far but it seems to work well. You can just copy and paste in your sequence and away you go (no non-ATGC characters allowed).
Is it possible you've downloaded a non-english version (although i gather the whole program would be non-english if that was the case). You could also try printing the help file.
rosylight,
are there any N's in your sequence? this may cause a little problem, although I am not too sure, as I have not come across this error message.
Nick
Hi,karyotyper and Nick
Thanks for your replies.
I've read the ABI guide again,and found that Nick was right .There must be several N's in my sequence.But, frankly speaking,I really don't know how to convert the N bases.(I'm a newer 
,please don't laughter at me )
And I also have trouble in pasting my sequence in FASTA format .I usually search my sequence in NCBI nucleotide database,but it seems that NCBI doesn't show sequences in characters that MethylPrimer Express requires(or I don't know how to convert it 
).So I turn to Ensembl,and...and I still have problems .For example ,I search U37574 (the ABI guide has it for example either),and the equivalent ensembl gene is ENSG00000012048.Its size is about 30,000bps ,but U37574 only 3,000 bp or so.Then,I run here for help~~~~
rosylight
hi rosylight,'
how are you saving your fasta sequences? if you are using word, I would suggest a more simpler text editor like notepad. if you are saving text in word, there are a whole lot of hidden characters and text within the file that I would say Methylprimer express wouldn't like.
Try saving your fasta format in notepad as a txt file and see if you are more successful, otherwise, can you share with us your loci of interest and I can try it on my side.
Nick
Hi again Rosylight
It doesn't matter whether you copy and paste your sequence from a txt file or a Word document - i've used both and it doesn't cause any problems. With copying in the FASTA sequence you need to make sure you don't copy in the top information line as this contains non-ATGC characters. This might be part of your problem. As Nick pointed out, you also need to make sure your sequence data doesn't include any N (non ATGC) characters as well.
Basically the rule is ONLY include sequence data consisting of the 4 DNA bases A,T,G and C.
Both the lines below will cause problems if pasted into MP Express because of the non ATGC character rule.
eg. >gi|1147602|gb|U37574.1|HSU37574 Human BRCA1 gene, partial cds
CTGCTGGNCCGGGTGCTAGGNCCCTGACTGCCCGGGGCCGGGGGTGCGGGGCCCGCTGAGCCCGCGCCCA
I must admit I haven't had problems using sequences that include N calls (and I also don't know how to get around this problem). The ABI Help file suggests using the most recent Genbank sequence you can find to prevent this. Assuming there are no N bases in your sequence of interest you can just hightlight the FASTA sequence data straight from Genebank (don't highlight the top line or delete it after you copy it in!), copy and paste it into MP Express using MP's edit-paste function or by using the Ctrl V keys on your keyboard.
Try copying and pasting the sequence below which includes a CpG island with a few hundred base pairs either side. It should work. Good luck!
TTCCTCTAGCTTCACCTAGAGATAGCGACACGTGGGTGGGATGGGGGCAG
GGTGCTCGGGGGCCTGGAGGCTTCCGGAAGGAGCGCTGGTGCTCACCTTC
CAGAGCCGATTCCTGAGTCAGGTAGTGCAGTGGTTGTAAAGTGCAGCATA
TTCATTTCCAAGCTAGAGGGTTTTGTGTCCGGATTCAAAGGCCCAGGCTT
GAGCTGGGTAGCACCATTTCTGTGGATGGGGAAGGAGTGAGGTCCCACTC
AGCTCCTCTCGCGTGCCCCCCACCCCAAGTGTGGCAGGAAGCCCCTCACC
TTTCATGTTGTGGGTTCTGGGAGCCCAGAGGGCAGCCATAGTGTGCCGAC
TCCGTGGAGGAAGTAAAGAAACAGACCCGCTTCTTGCCGCAGCCCCACCA
GCCTAAGGTGTTCTGTAGAAGACAGAGGTCGGGGCAGTGAGATGGTGGCC
CGGCGGGGCGGTCTGGGCAGGGCCGCGTCCTGACGCAGGGAGGGCAGACA
CGCTCACCAGGAAGGCCGGACGCGCCTCCTCTGTCCTCGCCGTCACACCG
GACCATGTCATGTCCTGCTTGTCACGTCCACCGGACCTGGCGTCTTGGCC
TTCGGCAGCTGGTGGGCACGTCCACCCCAGCTGGAGACCTGGCTGTGGGG
AGAACGAGAGAGTCGTGTGGGGAGAACGTGTTGGTTGTGTGGGGAGGGGC
GGGTGGGGGCTGAGGGTGGCAGAGGGGGAAAAACTCACCCTCGTCTCCAG
CCCGAACGCTGAGGCACCGATCCCGGCTCCGTCGCCGCCCGCGAGGCCCG
CCTTGGCCACGGGCTCTGGAGGCCAGTGCCTCCCGCTCGCCGCCCGCTGC
GCTCCTCACCCCTGCCTGCACCATCCTCCCTCCTGAGAGCTCATTCACTC
CGCCCCGCCCGCCTCGCCTAGTCTGGTCTCGCCCCATGCCCTTGACTCCC
CTGGATGCTGTACTGTCTGCCAAGCCAGCCCCAGGGGCTGAGCGGTGAGG
GCATACAGCGTCACCAAGTCCACTGTGGGCCCTCTCCGCACCAGACCCTG
GGCCGCAGTGCCTCGTGGGACCGGCGCCCGCAGGCCGAGCCCCTGCAGCC
TCCTTGCTGCGCAATGTCCCGGGGCCCCCCTCCCGTGGCCGCTTCGCCCT
CCTGGTGACGTCCTGCTGCAACTCCCCGAGCACTGCCTGTCTTCCCGCTC
TCCAGCCCTCGAGGCTCCGGCATAGGCCTGAGAAAGCCGTGCCGGAGCTG
CCCCTGTGCCTGCTACTAAATGAATTGCGGTGGGTGAGGTGGCAGCTGGG
GACCCCTCTGTCCTGTGTCCCCTGCCATGTCCCTGTCTGACCCAGGCCTG
GGGTACCACCCCACGTGCTGGACCCTACGCTGGCCACCCCTGTGCTCCCT
CCCTGCCCTCTTGCTCTTTCTGCCTGGAACGGGCCCATAACCCCCCAGCC
TTGCGCAGTCTCGGCTCCCCCCGAGAAGATGTCACCTTTGCTAACTCTCC
TGCCCCCATCCTGCCCCTCTGCTGGGAGGGTGTCTGCTTCTCCCCGCCAG
CCCTCGATCCCCTAAACCTCCTTCTTTCAGAAGGCTGGGGAAGCGAGGCC
TGGGGAGGGAAGGGACTCACCTGCCCGGCAGATGGGGTCCTCACCTGCCC
GCTGCTGCCAGCTACACCTCCGTTGCCCAGGCCCTGGGATCAAACCCTGC
Hi,karyotyper and Nick
Thank you for your advise!
I used to use word to save the fasta sequences.I'll try notepad next time .Nick ,one of my candidate genes is AF315385,would you mind try it if you have time ?
karyotyper,I paste the sequence you provide into Methylprimer express ,the outcome is that there is a CpG Island between 226 and 1295,right?iI still have another question to ask you : NCBI usually display sequences in characters"actg",do you know how to convert them into fasta format?
Good night!
rosylight
rosylight
Yes Rosylight, the CpG island is in that position so that confirms the program is running OK to that point.
With regard to your question about fasta format, load your sequence name (AF315385) into the NCBI nucleotide sequence search box, select go and click on your sequence name when it appears. This will bring up a lot of information about your gene including its sequence data.
In the top left of the screen will be a "drop down" box which will says Genbank. Click on the drop down box arrow and select FASTA. You can also limit the size of the sequence you want in the boxes just below the FASTA box (should say Range: from begin to end). So if your sequence is 20,000 bp and you're only interested in the first 5,000 bp you can enter 1 to 5000 and only these bps will be displayed in FASTA format when you select it.