Methylated + bisulfite-treated DNA works better than w/o methylation - Desulfonation responsible? (May/18/2006 )

Hi

Got these strange results, using a PCR-generated template (~680 bp): the template is split, one part is methylated enzymatically (SssI), the other one not. After this, both templates are bisulfite-treated (Zymo Research Kit; desulphonation step performed on column for ~30 min, according to protocol, then washed, eluted and EtOH-precipitated).

Performing PCR on these templates, using the same set of primers (methylation-unspecific, because not covering any CpG), we only get a product with the methylated template (but even after optimization, the yield is a little disappointing)...

So, since primer annealing should be identical for both templates:

Could it be that methylation, which protects a part of the cytosines present from bisulfite conversion to uracil, yields a better template because there are less Cs being sulfonated, and therefore, maybe less Cs which escape desulfonation (since sulfonated Cs inhibit PCR)?

without knowing your exact PCR conditions it is hard to say.

However, if you have a fully methylated template that was bisulfite converted, you would have more C's than the same template that was unmethylated at bisulfite converted. Then by inference, the base composition of both templates will be different and therefore the Tm of the product would also be different. The methylated template would have a higher Tm than the unmethylated and this may cause what you are seeing.

Again if you can post your PCr conditions up maybe we can all comment a bit more.

Cheers

Nick

I would think that a heavily methylated template would theoretically be tougher to amplify. Promoter regions are usually GC rich and designing primers in those areas can be very challenging due to secondary structure formation in GC rich regions. The secondary structure formation can prevent primers from binding to the template or sometimes from polymerase to extend along the DNA. Outside of methylation studies, I've actually tried sequencing promotor regions in the past. Sometimes it works other times it's almost impossible. That's just my 2 cents...

Dear Nick & Everybody,

We have a problem what we don`t understand.
The story:
We prepared BS PCR on BS treated DNA. The PCR products were directly sequenced which showed the methylated and unmethylated CpGs. After that these PCR products were cloned to TOPO TA pcr4 vector and transformed to E. coli. And randomly seletcted colonies were analyzed by direct colony PCR and were sequenced. And a problem is that all of them gave negative (unmethylated) results, however I expected the methylation in specific regions.

Have you ever seen like this?
Do you or anybody have idea what`s wrong?!

Thanks your help!

Bye,
CpGs

at what proportion did you see methylated and unmethylated CpGs and how many colonies were sequenced?

Nick

hmmm I was wondering,

how did you gauge methylation from the direct sequencing? were you comparing to a known standard? because the sequencing machine can play tricks on you, with a depleted C signal, it would over compensate for this lack, and you are then seeing an artefact.

Good luck!

Hi

Seems my thread became somewhat hijacked.
Doesn't matter. Here comes (a little delayed) the PCR primers & conditions we used:

Primer sense (28 nt, calc. Tm 65°C): tttattggtggagttattttaaaggagg
Primer antisense (26 nt, calc. Tm 65°C): acaaacctcaaaaccaccataataac

(expected) product size: 542 bp
gene: NF2, promotor region
bold: positions changed from C->T by bisulfite conversion

as you may see, no CpGs in the region of the primers - therefore, they should be expected to work with unmethylated as well as methylated template (after bisulfite treatment, of course )

Cycling conditions:
95 °C 5'
followed by 40 cycles of
95 °C 30''
56 -> 64 °C 45'' (gradient using gradient cycler)
72 °C 1'
followed by
72 °C 4'
4 °C pause

Components:
10-20 pg DNA (remember, it's a PCR product, not genomic DNA)
1 mM primer each
1,25 mM dNTPs each
1,5 -> 4 mM MgCl2
15 mM A.-sulfate
TrisCl pH 8,5
+/- 5% DMSO
1 unit Taq Pol

-> no product with the unmethylated (PCR-generated) template, just with the methylated one ...

And here is a response from the technical service at zymoresearch, where we bought our kit:

another thing cytotox, is that your sense strand primer is a little suspicious, I would say the conversions (t's) should be at the 3' end of the primers to ensure specificity to fully converted template. Indeed it is true that CG content would favour the methylated template over the unmethylated in the PCR but I suspect your sense primer (being rather G rich and ending in a run of 2X2Gs) that iti's playing funny games with your PCR.

Nick