Touchdown PCR for MSP? - (Feb/19/2006 )

I am now studying another gene' methylation status in lmolt-4 cell line,the FHIT gene.I set the pcr system as the literature,butjust get the primer dimer and smear othe than the band i want .My objective band is only 74bp,easily mixing up the primer dimer, how to identify them.

My classmates sugest that i should take the touching down pcr,which i had ever seen from some papers .But i couldnot get the paper.Could you tell me what is touching down pcr.For example,how i set the pcr parameters from 71℃ to63℃ for Tm.

Thank you very mudh! Looking forward to your help.

mspnewer

---

I have tried touch-down PCR before. It didn't help much. I don't know if your PCR machine allows you to decrement annealing tempearture during cycling. Read the machine's instruction.

74 bp is very close to primer dimer band. Try high concentration gels such as 2.5%.

---

Hi ,pcrman.
Thank you for your quick answer,I think the machine allows me to decrement annealing tempearture during cycling.I have another question to ask.Do you think that there coukd be two bands for primer dimer（i don't use the nested MSP). For i get the same two bands in positive and negative control,i think the two bands are primer dimer. Could the primer dimer could be more than 100bp? many thanks.
mspnewer

---

hey MSPnewer,

how long are your primers? and is there any evidence of them self annealing or have hairpins that could possible make a product greater than 100bp?

N

---

My primer sequence is as follow:

Primers for bisulfite treated unmethylated DNA
Forward: TTGGGGTGTGGGTTTGGGTTTTTATG
Reverse: CATAAACAACACCAACCCCACTA
Amplicon length: 74 bp
Annealing temperature: 64°C

Primers for bisulfite treated methylated DNA
Forward: TTGGGGCGCGGGTTTGGGTTTTTACGC
Reverse: CGTAAACGACGCCGACCCCACTA
Amplicon length: 74 bp
Annealing temperature: 64°C

could you help to do a analysis.Thank you !
mspnewer

---