Problems with bisulfite sequencing - (Jan/19/2006 )

Hello, everybody! I'm new about methylation study and I am trying to do bisulfite sequencing. In my first try, my pcr were wonderful, but my sequences not so good (in fact, they were awful).
But, looking at the sequence, I notice that all C's were converted in
T's, but there still a background of C's. I can suppose that should be
a heterozygote individual (I did not clone the fragment) or, the
conversion wasn't so good (I tried the regular protocol proposed by
Herman et al., 1996, with hydroquinone 10mM and bisulfite 3M for 16 h
in water-bath, no restriction enzyme digested). The problem I found is
that, even original T's (in original sequence) have a C's background!
As I have no idea of what is going on, although I thought that it's
probably a problem in my bisulfite modification, I'm writing to ask if
anyone can help me to find out if it's really my bisulfite modification
the problem (too long time in water-batch? the concentration of
reagents?)
Is there anyone who can help me?

Thanks and hughs

pithecia,

please post your primer sequences and the converted sequence you are trying to amplify,

more often than not, your primers have not been efficiently picked to amplify fully converted genomic DNA which is what sounds like in your case.

Your treatment should be fine, although I would have sheared your DNA either in a needle or at least with a restriction enzyme, this reduces the complexity and ensure denaturation to single strands for treatment.

good luck!

Nick

Hi, MethylNick,

This is the sequence:

L34545.1|HUMECADN Human E-cadherin gene, promoter region and 5' end

TtTAGAAAAATTTTTTAAAAAATTAGGtCGtTCGAGCGAGAGTGtAGTGGtTtACGttTG
TAATttAAtAtTTCAGGAGGtTGAAGAGGGTGGATtAttTGAGGTtAGGAGTTttAGAtt
AGttTGGttAAtATGGTGAAAtttCGTtTTGTAtTAAAAATAtAAAATTAGtCGGTGTGG
TGGtAtACGttTGTAGTtttAGtTAtTtAATAGGtTGAGAtAGGAGAGTtTtTTGAAttC
GGtAGGCGGAGGTTGtAGTGAGtCGAGATCGTGttAtTGtAtTttAGttTGGGtAAGAtA
GAGCGAGAtTtCGTtTtAAAAAATAtAAAtAAAAtAAAtAAAtAAAAAATTAGGtTGtTA
GtTtAGTGGtTtATGGtTtAtAttTGAAATttTAGtAtTTTGGGAGGttAAGGtAGGAGG
ATCGCTTtAGtttAGGAGTTCGAGAttAGGtTGGGtAATAtAGGGAGAtAtAGCGttttt
AtTGttttTGTtCGtttCGACTTGTtTtTtTAtAAAAAGGtAAAAGAAAAAAAAAATTAG
ttTGGCGTGGTGGTGTGtAttTGTAtTtttAGtTAtTAGAGAGGtTGGGGttAGAGGAtC
GtTTGAGtttAGGAGTTCGAGGtTGtAGTGAGtTGTGATCGtAttAtTGtAtTttAGtTT
GGGTGAAAGAGTGAGttttATtTttAAAACGAAtAAAtAAAAAATtttAAAAAAtAAAAG
AAtTtAGttAAGTGTAAAAGtttTTTtTGATtttAGGTtTTAGTGAGttAtCGGCGGGGt
TGGGATTCGAAtttAGTGGAATtAGAAtCGTGtAGGTtttATAAtttAttTAGAtttTAG
tAAtTttAGGtTAGAGGGTtAtCGCGTtTATGCGAGGtCGGGTGGGCGGGtCGTtAGtTt
CGtttTGGGGAGGGGTtCGCGtTGtTGATTGGtTGTGGtCGGtAGGTGAAtttTtAGttA
ATtAGCGGTACGGGGGGCGGTGtTtCGGGGtTtAttTGGtTGtAGttACGtAtttttTtT
tAGTGGCGTCGGAAtTGtAAAGtAttTGTGAGtTTGCGGAAGTtAGTTtAGAtTttAGtt
CGtTttAGttCGGttCGAttCGAtCGtAttCGGCGttTGtttTCGtTCGGCGTtttCGGt
tAGttATGGGtttTTGGAGtCGtAGttTtTCGGCGtTGtTGtTGtTGtTGtAG

And those are the primers:
*CDH1F: TTTTGATTTTAGGTTTTAGTGAGTTAT
*CDH1R: AATACCTACAACAACAACAACAA
Nested:
*CDH1NF: TGTAGGTTTTATAATTTATTTAGATTT
*CDH1NR: ACTCCAAAAACCCATAACTAAC

If you want to, I can send you one of the sequences.

I still don't understand why original T's in sequence have a C's background! C's don't suppose to be there, right?
Well, many thanks!
Hughs

hi pithecia,

i take it, the small t's are converted C's? if so your primers look fine, I am a little dubious with CDH1R because there are is a consecutive 3 base run of CAA. but the other three primers look fine and you are performing nested PCR which is also very good.

I also take it that you are performing direct sequencing, if you are getting a background level even in your T's of a C, this is because the basecaller of the DNA sequencer is somehow trying to compensate for the low C fluorescence signal in your amplicon....it is essentially very C poor and to compensate, the basecaller will bring up the C signal and what you are seeing is essentially the background noise.

Take a look at your chromatogram and look at the absolute fluorescence signals for each of the four bases (this can be found in the information menu or option within your chromatogram viewer), you will find that your C signal is at least 10 fold less than the other four signals....if this is the case it is normal, we have contacted ABI with regard to this and they are aware of it.....but that's about it from them, you will definitely get a cleaner signal if you were to clone your amplicon and sequence them.

I can post an example when I am back in the lab on monday.

Nick

Hi, Methylnick
Thanks so much for you answer. I checked it out and the C's proportion is really smaller than the others. Anyway, I'm posting a figure showing my problem and the converted sequence just for a comparision.
Once again, thank you so much.

Hugs


Converted sequence (to compare to the chromatogram one):

tAttTGTGAGtTTGCGGAAGTtAGTTtAGAtTttAGttCGt

hi,

hmmmm this chromatogram seems odd,

here is an example of mine, at CG sites, there is also a T so some have been called as N

there is a basline background C signal, however the chromatogram you have shown us seems to suggest that C peaks are real.....although I have not used bioedit before and it maybe normalising the height of the C peaks with the other bases.

Nick

Hi, Methlynick,


Do you have any idea of what is going on with my bisulfite sequencing? I don't have any


Thanks for everything.

Hugs

I would say that the peaks you see are derived from direct sequencing associated background, those peaks will dissapear if you were to clone your amplicon and sequence a few of the clones.

This is the approach I have adopted for my studies.

Nick

Thank again, Nick. I'll try to clone before sequencing.

Hugs

Why is it that direct sequencing causes the noise?

Briefly, how do you clone the fragment? In a vector?

I don't quite understand how this makes it work.