NEB Restriction Enzymes and Buffer - Restriction (Aug/28/2009 )

Pages: Previous 1 2

Hello lumptal,
no I am not
I copy-pasted the sequence in between the two restriction sites to answer the question about how close they were

For the final cloning I need to cut out KpnI/SalI a 1200bp insert from a vector and ligate it in a vector cut KpnI/SalI
I can check the restriction was complete for the insert but obviously not for the vector.
Unless you have any tip to share

-bac-

Hi
I see the things start to work out.
But it seems problematic that You obtain high number of colonies on the background control.
Maybe You should use Alkaline Posphatase treatment of vector to reduce the background signaling.

bac on Sep 2 2009, 04:57 PM said:

Hi there,
thank you very much for all your precious inputs.

@Michaelro, the XbaI site was
ACTAGT TCTAGA GCGGCCGCCAC
and yes: the 2 vectors I wanted to cut SalI-HF/KpnI and use as backbone had been both sequenced and were fine.

Concerning the second restriction KpnI/SalI-HF
Using a new tube of KpnI seemed to work beautifully for the plasmid carrying the insert that got cut out and was then gel-purified. The vector backbone got at least linearized (and was then column-purified), although my control ligations with only backbone cut SalI-HF/KpnI and no insert added gave lot of colonies. I am PCRing few colonies with primers targeting at the edges of the insert to see if I get any good clone.

@lumptal

are the sites that worked both contained in the vector/ part with selectable marker gene? (if from a transformation)

I do not get the question, sorry.

edit: how close is close?

GGTACCGGGCCCCCCCTCGAGGTCGAC
KpnI SalI

I want to share with you here below the answers about my doubts I got back from NEB and from the local vendor of NEB products:
Thank you again

Local vendor:
--------------------
Question 1) answer:

info about the HF new enzymes can be found here:
http://www.neb.com/nebecomm/tech_reference.../hf_enzymes.asp

http://www.ozyme.fr/_prod/gammes/neb/pdf/neb-expression.pdf )
FYI: A sampler of HF enzymes is sold for 15$ or 15EUR
http://www.neb.com/nebecomm/products/productR3000.asp>

Question 2) answer:

The buffers should be stored at -20 oC. Some of these buffers contain BSA that needs to be stored at -20 oC. I think this is the main reason why they should be stored at -20 oC.

NEB:
---------
Question 1) answer:

We have not changed formulation of our enzymes, but simply retested the enzymes in all 4 of our buffers to see if we could make the switch to buffer 4. All the enzymes we switched previously had shown at least 50% activity in NEBuffer 4 (most were 75% and 100%). For the majority of enzymes there was no change in the enzyme formulation. In a couple of instances we adjusted the concentration of the enzyme (although this was a less than a 2 fold change). As we recommend 5-10 units of enzyme for a 1µg DNA digest in 1 hour, this change is not noticable and the enzyme can be used in NEBuffer 4 or in the original Buffer.

Question 2) answer:

We have always stored our buffers at -20oC to protect against bacterial growth, as any growth at all is likely to introduce nucleases into the digest which would cause smearing and poor digests. Long term storage at 4oC is more likely to result in bacterial contamination in the buffer and for that reason we suggest storage at -20oC.

-Michaelro-

Hi Michaelro,
well -I am crossing my fingers- I should have 2 good clones (1 per vector backbone) out of 32 (16 per construct) screened. They will be sequenced next week.
Isn't this a poor score? -How many colonies do you usually screen?-
Would you anyway advise CIPing opr SAPing the vector backbone even for a cloning done through two restriction sites?

This has been a very unlucky cloning: lot of problems. Indeed it has been the fist cloning I designed myself from scratch and I have learned a lot out of it.
I still do not find the final word about the best buffers and BSA storage, but I will keep them at -20 and change them more often in the future, just to be safe.

Thank you for all the tips!

-bac-

Hi
You're wellcome
We are using routinely CIP treatment of vector because highly competent cells will give very strong background unless You perform the treatment.
Clonig itself is a tricky thing and I can tell You this after 8 years experience.
I'm used to invest as much time as needed to plan the cloning because You will have the reward afterwards.
I may tell You what is my way to do it.
1. Exact planning.
2. Preliminary check: cutting the vector and insert plasmids with cloning enzymes: double restriction and each enzyme separately to make sure I obtain the expected fragments before entering the ligation step.
3. Preparative restriction. The starting amount of vector and insert plasmids I calculate to obtain final amount of at least 0.5 mictogram vector and insert before ligation.
4. CIP treatment of vector (add the CIP directly to the restriction reaction)
5. Running the restriction reactions on gel and gel extraction of the desired fragments.
6. Ligation reaction according to 1:3 vector:insert ratio.
7. Transformation
8. Screening of colonies (PCR or miniprep + restriction).

Usually it works and it allows You to encounter the problems before entering the time-consuming steps.
Good Luck
Michael

bac on Sep 5 2009, 01:24 PM said:

-Michaelro-

Pages: Previous 1 2