probe conc. of Asymmetric PCR - (Aug/01/2009 )
Does anyone know what concentration I should use for Asymmetirc PCR? Since the probe can't prime to the target (no extra melting peak apper).
Currently, I use
Reverse Primer 500nM
forward primer 100nM
probe 500nM
Thank you
-Sonia-
The unlabelled probe is
5' AAGAGATTCTCACTTGGAATGCTGAA 3'--phos
What is the possible factor that make it can't bind to the sequence?
-Sonia-