Protocol Online logo
Top : New Forum Archives (2009-): : DNA Methylation and Epigenetics

CHIP primers - rat ROCK1 (May/12/2009 )

Dear all,

I have to do some CHIP QPCRs to check the Histone acetylation. I am not familiar with the primer design on the promoter region. As far as I know, primer design is a crucial part on the CHIP QPCR. Could any one please help me on primer design?

Gene-rat ROCK1
Accession no-NM 031098.1

-Raviraj-

Here you go.

A 500 bp promoter sequence (very CpG rich)
AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC

Two sets of ChIP primers on the promoter:
LEFT PRIMER 5 20 59.99 55.00 3.00 1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER 104 19 60.93 63.16 4.00 2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER 378 18 62.49 61.11 4.00 0.00 9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER 477 18 60.60 66.67 3.00 3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100

Hope that works

-pcrman-

Thanks a lot pcrman :D

-Raviraj-

Hi Pcrman,

What software did you use for designing these primers?
Thanks

Mura

pcrman on May 13 2009, 03:08 AM said:

Here you go.

A 500 bp promoter sequence (very CpG rich)
AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC

Two sets of ChIP primers on the promoter:
LEFT PRIMER 5 20 59.99 55.00 3.00 1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER 104 19 60.93 63.16 4.00 2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER 378 18 62.49 61.11 4.00 0.00 9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER 477 18 60.60 66.67 3.00 3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100

Hope that works

-mura-

The primers were designed using Primer3. You can use any program to design ChIP primers. The important thing is that you need to decide which region of your gene you want to examine.

-pcrman-

Hi pcrman, how do i determine which region is the promoter sequence from the sequence I obtained from fasta format?

-giny-

would you please let us know how did you determine the promoter region. and can i use Primer Express from ABI to generate CHIP primers?
There is one databse in the following link. Is this good?
http://rulai.cshl.edu/cgi-bin/TRED/tred.cg...=searchPromForm
Thanks


pcrman on May 13 2009, 04:08 AM said:

Here you go.

A 500 bp promoter sequence (very CpG rich)
AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC

Two sets of ChIP primers on the promoter:
LEFT PRIMER 5 20 59.99 55.00 3.00 1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER 104 19 60.93 63.16 4.00 2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER 378 18 62.49 61.11 4.00 0.00 9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER 477 18 60.60 66.67 3.00 3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100

Hope that works

-epigenetics-