mouse Gapdh chip-qPCR primers for control! - (May/04/2009 )
Hi, all, I am a fresher for chip and I really need your kind help.
I am doing chip on mouse naive CD4+ T cells treated with retinoic acid(RA). My questions are as follows:
1. For chip qPCR, I need a positive control. I have anti-acetylated H4 at hand. So I think I only need a pair of primers for housekeeping genes. The question is I don't know which housekeeping genes are not affected by RA. I checked a lot of papers and it seems that Gapdh is ok. I am still not quite sure. Does someone know the exact answer?
2. If Gapdh is all right. Does anyone know the mouse Gapdh chip-qPCR primers? I can only find the human ones online. I tried to design myself. But I found the Mu Gapdh promoter region shown in Ensembl is defferent from that from other website, which makes me confused.
I very appreciated your great help!
Ge
no one knows chip-qPCR primer sequences for mouse Gapdh promotor? Frustrated! ![]()
Hi,
Based on the human primers used for ChIP in Kawamoto et al 2008 (Int.J.Cancer 123: 535-542, PubmedID 18404682) I have found primers for mouse in the same region.
I use: forward: AGAGAGGGAGGAGGGGAAATG
and reverse: AACAGGGAGGAGCAGAGAGCAC
This gives a product of 200 bp.
They work both in 'normal' PCR (Promega GoTaq Green Master Mix, Tann=60C) and Q-PCR (Thermo Scientific ABsolute Blue SYBR Green Rox mix, Tann=63C)
It's a bit late (I'm new to the forum), but I hope this helps.
Good luck.
Judith
hello
i have got multiple bands in pcr after chip based on your mouse gapdh primers. can you help me out?
1uL of template for PCR with 8-10ng/ul conc.
chromatin yield is good 400-600ng/uL and fragmentation is 200-500bp size.
also in final purification after reverse cross linking, is it better to do phenol- CHCL3 purification or column is better
any other thing i need to get right?
HI.
I am currently having similar problems.
I just switched to PAGE purified primers, hoping that that would be better, but it's not.
When I do a standard curve, with normal, non-ChIPped DNA, I get a nice clean dissociation curve: one peak around Tmelt=87. (63C annealing temperature).
For the input samples the dissocation curve is also nice, in most cases.
But for the AB- and ChIP samples, there is often another peak, at a lower Tmelt.
I loaded the samples on gel, but for AB- and ChIP I do not see a band, whereas I see a clear one for 1/50 input. Strangely enough, the Ct values were lower (thus more product) for AB- and ChIP.
SO, I'm currently very puzzled myself.
I'm sorry I cannot help you.
After reversal of the crosslinks, I use Qiagen's QiaQuick PCR purification kit. I have not compared the results with phenol/chloroform/EtOH precipitation.
I actually have a question for you. How do you quantify your chromatin?
I looked into doing it with NanoDrop, but I don't know if it knows how to deal with the DNA/protein combination, and which constant to use.
Good luck. In case you have optimised the PCR, I would love to know how!
Judith
judithb on Thu Sep 2 14:52:00 2010 said:
HI.
I am currently having similar problems.
I just switched to PAGE purified primers, hoping that that would be better, but it's not.
When I do a standard curve, with normal, non-ChIPped DNA, I get a nice clean dissociation curve: one peak around Tmelt=87. (63C annealing temperature).
For the input samples the dissocation curve is also nice, in most cases.
But for the AB- and ChIP samples, there is often another peak, at a lower Tmelt.
I loaded the samples on gel, but for AB- and ChIP I do not see a band, whereas I see a clear one for 1/50 input. Strangely enough, the Ct values were lower (thus more product) for AB- and ChIP.
SO, I'm currently very puzzled myself.
I'm sorry I cannot help you.
After reversal of the crosslinks, I use Qiagen's QiaQuick PCR purification kit. I have not compared the results with phenol/chloroform/EtOH precipitation.
I actually have a question for you. How do you quantify your chromatin?
I looked into doing it with NanoDrop, but I don't know if it knows how to deal with the DNA/protein combination, and which constant to use.
Good luck. In case you have optimised the PCR, I would love to know how!
Judith
In your ChIP protocol, do you use any carrier DNA (sheared salmon sperm DNA or something similar). Could it be possible that your primers are recognizing sites within your carrier DNA? I know it's unlikely but an easy thing to test. You can use tRNA rather than salmon sperm DNA as a carrier (we've used it and seen no difference in background or efficiency of pull down) and see if that other dissociation peak goes away.
Thank you for thinking along!
But no, I don't. I don't block my beads, or I don't use it to aid DNA precipitation.
Judith
Hello everyone
I am doing regular PCR not qPCR and I got the ChIP to work
I have used a new pair of primers specific to the mouse GAPDH Promoter and the sequence is
Forward - ACC AGG GAG GGC TGC AGT CC
Reverse - TCA GTT CGG AGC CCA CAC GC
Primer annealing temperature - 60C for 30 sec and 34 cycles should be enough - PCR Product is close to 240bp
Input DNA should give a great result with this primers
Let me know your comments
- Rishi
