Restriction site - efficiency of restriction (Mar/28/2009 )
Dear all expert,
I would like to ask you guys about restriction site.
If I had design a primer for Insert PCR,
With forward primer of AGATCTATGGCGTTGGCGTTG (underline is BglII digestion site)
Notice that I made a mistake and it should be gtAGATCTATGGCGTTGGCGTTG and providing more space for the BglII to hang on it. I wonder whether the enzyme will still do its digestion as the amplicon might not have enough space to hang onto the DNA.
Please give me guidance and advices about this.
Thanks.
According to NEB's chart, there's no digestion by BglII without at least a two-base overhang.
Hey,
Not sure if it would cut or not but you can always do the PCR with pfu and perform a blunt end ligation in say Eco RV cipped pBS vector or SnaBI/ Stu I cipped Litmus28. Clone it there and then cut with Bgl II.
Hope it helps
Best
TC
Alternatively, you could TA clone it, if you have the correct TA vector and used Taq, and digest that clone with BglII.
thank you all. I will redesign the primer.

