finding sequence to IL21 - (Mar/21/2009 )

Hi Everyone
I need some help with finding the cDNA sequence of humean IL21 split to each exon
and to know what is the sequence of the first intron in the whole gene sequence of IL21
and to know the first 500 bases of the promoter sequence and which factors it can link
thanks

What I usually do is:
Go to NCBI and search the "GENE" data base for your gene.
Go into it and scroll down to the bottom of the blue list on the rite.
Find Ensembl and press it.
Press on the Transcript ID number.
On the left hand side of the screen hit Exons
There you have it.

I find it e.z.er to find the gen in NCBI and that's why I change over in the middle instead of doing it all in Ensembl.

thanks for the help.

is there any chance you could help me find the introns sequences?

This link will lead you to IL21 sequence. Exons are high lighted. The sequence before the 1st exon is promoter sequence. If you only want the first 500 bp promoter sequence, click "Configure this page" link on the left of that page, and input 500 to the box "5' Flanking sequence (upstream): ".

For your convenience, I list the sequence here:

Promoter (500bp)
CCTCTCCTCCTACTTTTATGATGGAATACTGGATGATTTTAGTCAAAAGACATAGTTATT
ACCATAAGAAAAAGTCCTGCATGAAAGCACATGTTGCCATCTTACTCATTATCAAAGTGC
CCTTATGACTGTCAGAGAGAACAGGTAAGATGCCAGGGGAGGCCGAGAAAAAGAGATCAA
AGTGTTTTTGTTTACTTTTTTGAAGTCTTGTAGTACCTACTGTTTATTATACATACTTCT
TGATTCATGCTGAAAATTGGAATTCACCCATTCTCTCTTTTTCCTGTCAAAGATGCAGAT
GGGGCACATTTCGTTGACTCCATCAATCCCTGCCCCCACACATTAGCACATGCACACGTA
TACCTAGCCAGTGGAAAAGAAAAAAGAGTTACTCACATTCATCCATTTTACAAAGATTTC
CAGGCTGCAATGGGAGGGCTTTACCTCTCCCTGAAGGATGAATAAATAGGTAGCTTAACT
GACAACCTGTTCTCAGTCAA

First intron:
GTAAGACTATATTTGTCACAACAAAATCTAAATCATACTTTTCAATTAATATAAAAGGAGGGTTTGGCTTA
TAAAAATAACTCAGAACAAATTTTCTTTTGCTCTAG

fadlone on Mar 22 2009, 04:35 PM said:

When you are in Ensembl at the Exon view,
on the bottom left, hit "Configure this page"
check the "Show full intronic sequence",
scroll to the top and hit "SAVE and close"

thanks for the help

just one more question, is the promotor sequence is on the positive or negetive strand ( I think its on the negetive)?
and what sould I do if it on the negetive if I need in the next step to find witch Transcription Factor Binding Site are found on it?

Obtain the sequence for the reverse strand and then go to this site:

http://www.oxfordjournals.org/nar/database/a/

and search for transcription factor binding databases.

I didn't quite understood how I suppose to find if the sequence is on the positive or negative strand

fadlone on Mar 28 2009, 08:57 PM said:

You can see by the directions of the arrows that it's on the negative strand.

thanks