Cloning protein of interest into lentiviral vector - help - I have no experience - (Jul/13/2019 )

Hi there,

 

This is my first time ever cloning. I was wondering if someone can help.

 

I need to make a stable HEK 293T cell line expressing my protein of interest tagged to HA. 

 

I have done transient transfections with my protein of interest with some plasmids I got from another lab. The vector I used to do the transient transfections was in a pRK5-HA-GST vector. 

 

I have a few really dumb questions:

 

1. My first question is do you always need virus or flp-in cell lines  to make stable cell lines?

 

2. Or can you make stable cell lines simply by transfection and selection of an appropriate vector suitable for stable cell lines? If so what are these vector?

 

3. If I wanted to clone my protein of interest into a lentiviral vector, which vectors can I choose? How do I take out my protein of interest from the pRK5 vector and put it into a lentiviral vector.

 

I know the basic idea that you use restriction enzymes to cut the plasmid and ligase to glue your gene of interest into your new plasmid but I don't know how exactly to do this.

 

I would be very grateful if someone could correspond with me directly via email and give me detailed instructions? I could send you more info on my plasmid etc. Really need someone to teach me how to clone. Have no experience and nobody in my lab who can help.

 

Thanks 

 

1) no you don't need flp-in or viruses to make stable cell lines, you can also use things like CRISPR, or even (with the right vector) have a selection process, just like you do for bacteria, that allows maintenance of the plasmid within the cell. This requires the right sort of plasmid that can be copied by the cell, there are lots of different ones around. Check out Addgene.org for a good repository of plasmids. There's a good basic summary here. A common vector used for this is the pcDNA3 series from Life Technologies.

 

2) see above

 

3)I don't know about lentiviral vectors, but the cloning process is the same. Basically what you need to do is look at the sequence for the vector+insert you have right now and determine if it can be subcloned into the lentiviral vector you choose. To do this you look for common restriction sites (you may need to learn about isoschizomers) within the multiple cloning site (MCS), its the region with lots of restriction sites within maybe 100 bp of each-other. If you can find ones that suit for the correct orientation of your insert, then you can use those to digest out your insert, digest the target plasmid and then ligate the insert and target together.

 

If you can't find common ones - fear not. It is easy to generate the sites you want with PCR - design primers for your insert that have a 5' tail consisting of 6 random bases, your RE site, then a spacer (3-6bp usually) and then your insert sequence. It'll look something like this (the GGTACC is the sequence for Kpn1 restriction, substitute your desired RE sequence):

 

NNNNNNGGTACCNNNNNfirst_or_last_20_bp_of_your_insert

 

You then amplify by PCR (use a high fidelity enzyme with proof-reading), digest the insert and target plasmid with the desired enzyme(s), ligate. You can also use this method to add a tag or anything else you want - just don't forget to change the ATG position and keep the insert in-frame.

 

If you are really stuck - and have plenty of money floating around, there are a couple of other options - you can get genes made for you by a number of companies, and most of those will insert it into your vector of choice if you supply the vector and pay a bit more. Or you can investigate TA cloning, specifically Topo-TA kits. TA cloning is where you just amplify which-ever insert you want using Taq polymerase, it adds an A overhang on the ends of sequences, then you use this to ligate into the vector. The Topo-TA kits make this very simple by adding a ligase to the cloning site that will do it all for you. You just have to check the insert orientation once cloned.

Hi Bob

 

Thanks very much for the detailed answer. This is the link to the plasmid I have. It was originally from Addgene. This is the link to plasmid I currently have and used for transient transfections:

 

https://www.addgene.org/19304/

 

I have also attached an image of the plasmid. I would be grateful if you could check the link and plasmid details to advise me.

 

I need to cut out the insert and clone it into pLenti PGK Blast and/or into pCDNA3 (with blast resistance). I need to keep the HA-tag.

 

I am not used to looking at DNA sequences so having difficulty understanding whether the HA-tag comes from the pRK5 vector and so I need the tag already encoded in the new plasmid or whether the HA-tag is already encoded in the insert?

 

Would you be able to recommend which restriction enzymes I need to use to get the HA-Rag C insert out from the current plasmid and a protocol for getting it into my 2 new plasmids for stable cell line generation. I would like to try both lentiviral and the pcDNA3 methods of stable cell line generation.

 

I think if I can go through the whole process once, with someone guiding me, I should be better doing it on my own next time!

 

Really appreciate your advice. 

OK, that's a pretty comprehensive plasmid map, most are simpler. From it I can see that you actually have two tags on your protein - HA and Glutathione S transferase (GST), these are both N-terminal (i.e. appear before the start of your gene of interest), and that the HA is before the GST. The MCS in this case has been split into at least two parts - there will be a parent plasmid with it as one contiguous region, but yours  starts with BbsI (position 1688 from the ori), and ends with BamHI (3996), the insert is between these two positions and is the reason the MCS is split. The HA and GST were already in these plasmids as you can see from the cloning information, which states that the insert was cloned using SalI and NotI.

 

I can also see, by comparing the restriction sites between this vector and pcDNA3.1(+), that you have some that are compatible, but these are in a different order in the two plasmids. This would result in your insert going in backwards, so you can't do a common subcloning into that vector. So, your best option is to amplify the insert using PCR and add the desired restriction sites and make it easy for yourself.

 

The HA can be either on the plasmid when you clone in, or it can be part of the insert. If you want your gene as it is with both tags, simply get the sequence from Addgene, look for the open-reading frame (ORF) that encodes your gene of interest and design primers based on that. The gene specific sequence will be the first and last 20ish bp of your insert. Take a look at the plasmid you want to clone into - look at the MCS and choose two restriction sites. I recommend sticking with two of the more easy ones, something like EcoRI and BamHI works well for pcDNA3.1.  If you are using pcDNA3.1 and those sites; EcoRI will go on the forward primer and BamHI on the reverse so that the insert will be oriented correctly when you come to express it. Now you simply do a PCR, digest insert and target, then ligate. Note that EcoRI and BamHI work well in Phusion PCR buffer, though the HF versions do not. See here for more information on the enzymes and their activity in PCR buffer.

 

If you do not want the GST tag (I wouldn't, tags can interfere with folding of the proteins...). You can add the HA tag (see here for sequence) to either the forward or reverse primers, depending on whether you want a N- or C-terminal tag. Note that if you want it N-terminal, you need to add an ATG start site before the tag sequence, so the primer would look like this:

NNNNNN GGATCC NNNNNN ATG TACCCATACGATGTTCCAGATTACGCT NNNNNN YOUR_DNA_SEQUENCE

6bp    BamH1 spacer start HA tag                   spacer your_DNA...

Spacer after tag must be multiples of 3 to keep sequence in-frame.  Conversely if you wanted a c-terminal tag you would need to add a stop codon. The annealing temperature of the primers does not include the non-sequence specific stuff like the tag, just work it out off your DNA sequence. 

 

There's a lot more to it than that - go to your local university library and find the book "Molecular cloning: a laboratory manual" by Sambrook et al., there is a lot of excellent information in there.

Thanks for the great response again. 

 

I still have questions :(

 

I know you suggested using pcDNA3.1(+) vector  but I noticed there are 38 of the pcDNA 3.1 vectors (bit confused what these others are apart from the resistance gene differences). 

 

Currently im looking at this one: https://www.addgene.org/vector-database/2093/

 

which is only available from Invitrogen. Neo or blast resistance should work for me as I already have hygro and puro resistant genes in this cell line I'm planning to transfect. 

 

Questions:

 

1. You suggested using EcoRI and BamHI - this would enable me to take the full HA-GST-RRAGC insert directly from the plasmid but you mentioned that the restriction sites are in a different order to the current plasmid (which I can see in the map). For this reason, you suggested that I can't do a simple sub cloning but would have to amplify the insert and my own restrictions sites.

 

Now this is more difficult for me to understand and do so I would prefer to do subcloning, which I assume means I can restriction digest the current plasmid where the insert is and also digest the pcDNA3.1 and then purify my insert and plasmid by electrophoresis and then combine the insert with the new digested pcDNA3.1 plasmid using ligase. Since the EcoRI and BamHI are in a different order in the pcDNA3.1, can I not use EcoRI and NotI or will this cut off some of my insert? And is NotI restriction enzyme harder to use? 

 

2. For cloning into a pLenti PGK blast or pLentiCMV blast , which restriction enzymes would you recommend using, which I can sub clone rather than amplify insert & my own restriction sites? This cell line Im transfecting has been previously virally infected with other genes using pLenti plasmids so I know we have some of these plasmids in the lab. I noticed in these plasmids, there are EcoNI sites - are these different to EcoRI?

 

3. Finally can you give me a protocol for each of these stages? I know Im asking a lot of dumb questions, just never been taught this stuff before so I'm in a pickle!

 

Really appreciate the help!

1) EcoRI and NotI would work just fine. The insert was cloned into the vector you have using NotI, so that should be fine. EcoRI looks like it is outside the HA, so that should work too. NotI shouldn't be any harder to use than most of the other ones. If you used EcoRI and NotI it will be best to do the two restrictions in separate reactions as the most efficient buffers are different for both. Note that this means you need to use a lot of DNA for each digestion step as you will need to purify after each digestion. I'd recommend starting with 2-4 ug, and having about 1 ug in your final digestion.
 
Note that when you do your ligation you should work out the molar ratios of the insert to vector - you do this from the relative lengths. There's a calculator here to make it easy. 1:1 molar ratios often work, but not always, so you may need to try a few different ones.
 
2) I don't know much about the lentiviral vectors, but I think that you need to start with an entry vector and use the Att1 sites for recombination into a destination vector. I think this is means that you don't need restriction enzymes apart from to get into the entry vector. I've never used this system so I can't advise much more than that.  EcoNI is different to EcoRI.
 
3) Detailed protocols would be difficult to write out here, and are covered well at this site.

 

However, some pointers and a general outline will be helpful. Assuming you have some purified plasmid to start with.

 

 

  1) Restriction digestion of plasmid to get linearized empty vector with incompatible ends

• You need your plasmid DNA, the restriction enzyme and its corresponding buffer.
• Set up 50 ul reactions using a 4-fold excess of enzyme (i.e. if you have 1 ug plasmid, use 4 U of enzyme). Gel purification used in later steps only has about 10% return; digest a lot of DNA, but I wouldn't go above about 5 ug/reaction.
• Incubate at recommended restriction temperature (often 37 C, but not always) for the recommended time (usually 1 h). Do not over digest.
• Run the digested plasmid on a gel and cut out the digested band - you need to run undigested plasmid and ladder to compare, Hopefully you will see a single bright band of the right size. Gel purify this band. 
• Repeat digestion step with other enzyme. Purify this one with a regular DNA extraction, you most likely won't see any difference to the previous step if run on a gel. You can however assess if this digestion is likely to have worked by digesting uncut vector and seeing if it has linearized. 
• I do not recommend using a phosphatase to prevent vector self-ligation, they are hard to remove and interfere with subsequent steps. Most protocols you will find generate incompatible overhanging ends and do not strictly need dephosphorylation.

  2) Digestion of vector with insert to extract insert.

• This is just like above, so repeat the first 3 steps 
• Repeat step 4, but instead cut out and gel purify the insert - this will be a shorter band - determine the correct size and compare to a DNA ladder. 

  3) Ligation. Note the troubleshooting steps here

• Don't use more than 100 ng per reaction.
• Work out the molar ratios and test several
• Overhang ligations, like you will probably do, work well in less than 1 h usually. 
• Always always always run a control that contains digested vector only - if you see a lot of colonies (more than about 50, compared to 200+ for vector and insert ligation) from transforming this, your digestion of your vector has not worked well at the second step and you will need to repeat it or screen a higher number of colonies.

  4) Transformation. 

• you've probably done this before. If you haven't let me know and I can give more pointers.

Thanks again! I have learnt so much from this discussion!

 

I discussed the cloning with my boss and sadly he really wants me to use lentiviral vectors instead of pcDNA3.1 as he believes stably integrating plasmids into cells causes unwanted changes in the cell.

 

So I'm back to square 1 as it seems I have to integrate attB sites to flank my gene. I know you said you don't have experience with the viral vectors but given the below info from the Gateway cloning guide for designing attB primers and the link for my current plasmid on Addgene, could you please advise me if the below primers would work for doing this.

 

I have attached the Gateway Technology user guide where it provides instructions for designing attB PCR primers on pp12-14. I have generated the below primers using the info given in pp12-14 of this manual but I'm still not sure if I've done it right as I've never designed primers. Also not sure if its all in frame as it should be.  

 

I would so grateful if you could check for me whether these below primers work given the instructions in this manual? 

 

Fwd attB1 Primer:

 

5'-GGGG-ACA-AGT-TTG-TAC-AAA-AAA-GCA-GGC-TTC-(GAA-GGA-GAT-AGA-ACC-ATG-G)GC-tac-ccc-tat-gat-gtg-cct-gac-tac-3'

 

Underlined red section is 25bp attb1 site

 

Green section is Shine Delgarno sequence

Blue section is Kozac sequence for protein expression in mammalian cells

Pink section is first 24 bases in the HA tag of the HA-GST-RRAGC section of the pRK5 plasmid 

 

The 24 bases are just from the HA-tag in the plasmid. Is this primer sufficient to pick up the HA-tag followed by GST tag followed by RRAGC (my protein of interest)?

 

Also there seems to be one extra base thats not in a triplet before its gets to the start codon after I followed the manual instructions - does this not matter?

 

Rev attB2 Primer:

 

5'-GGG-GAC-CAC-TTT-GTA-CAA-GAA-AGC-TGG-GTC-CTA-GAT-GGC-GTT-TCG-TGG-CGT-GCC-3'

 

Underlined red section is 25bp attb2 site

Underlined pink section is stop codon

Pink section is last 18 bp of RRAGC

 

 

 

 

 

 

 

 

Those look fine to me. You probably don't strictly need the Shine-Delgarno sequence in the forward primer, but it won't hurt to keep it in there. If you copied the sequences from the manual, they should be absolutely fine. I can't see the extra base that you mention, all the bases there are ones that are in the manual, or are for the HA tag. The reverse primer looks good too.

 

The 24 bases will most likely work. You probably don't need quite that many to do the PCR, but so long as the annealing temperature of this section is below about 72 C, then it should work. This also applies to the reverse primer.

 

Make sure that you read the rest of the manual and follow the instructions, particularly those about the E. coli strains to use. In general I recommend getting the basic kit to start with, like the ones that are mentioned on the front page of the manual you attached. However, I see that both of these are discontinued, and I don't know what replaced them. Get in touch with their technical support service - they are good at what they do, they actually have proper science nerds (like myself, though I don't work for them) manning the support system, so they should be able to help.

I just wanted to check a few things esp Q no.3:

 

1. The ATG start codon falls within the Kozac sequence. Is it always supposed to be like that?

 

2. Do the bases in the primer not need to be in multiples of 3 before the start codon?

 

3. I am worried that I have left out a base or incorporated too many bases by accident 

 

Why is my HA sequence in the forward primer different to the HA sequence you gave me in one of your suggested PCR primers for incorporating restriction sites? (I obtained my sequence from looking at the original pRK5 plasmid sequence containing Rag C https://www.addgene.org/19304/

 

attB1 Fwd primer I designed:

5'-GGGG-ACA-AGT-TTG-TAC-AAA-AAA-GCA-GGC-TTC-(GAA-GGA-GAT-AGA-ACC-ATG-G)GC-tac-ccc-tat-gat-gtg-cct-gac-tac-3'

 

section in pink is HA-tag on the pRK5 plasmid as far as I understand?

 

 

 

Your primer from earlier on:

NNNNNN GGATCC NNNNNN ATG TACCCATACGATGTTCCAGATTACGCT NNNNNN YOUR_DNA_SEQUENCE

 

section in pink is HA-tag? which is different to sequence I derived from the plasmid.

 

In fact the HA-tag sequence on the Addgene website (in link below) seems different to mine and yours: 

 

https://www.addgene.org/55182/sequences/

 

I'm really confused 

 

When I designed the primers following the manual, the sequence up until the HA-tag is what they suggest but I'm not sure if after that point I have picked up the correct sequence from the plasmid? Would you please be able to check this for me? I don't want to clone the wrong sequence in - just worried.

 

Thanks so much again

1)Yes, the ATG is part of the Kozac sequence. You actually have a minimal Kozac sequence there, the full one is (GCC) GCC RCC ATG (G) the last G helps but is actually not entirely necessary either, though it is highly conserved, along with the R. 

 

2) No, they don't need to be in multiples of 3, this is only necessary after the start codon so that they encode the correct amino acids. Having said that, with the use of recombination via the attB sites, there are special considerations with respect to frame, but I'm not sure exactly on those. So long as you copied correctly from the manual, there shouldn't be a problem.

 

3) You have done the correct thing and used the sequence from your plasmid. This will ensure that your primers are specific for your sequence and will work at the correct melting temperature. Don't worry about the bases I used - I copied those from somewhere else, not from your plasmid sequence. There is some wiggle room in terms of exactly which bases encode the various amino-acids in the HA tag, so different sequences can encode the same amino-acid sequence. To complicate things even more, there are different HAs for different species, so a mouse HA is different to a human HA. Use the one from the plasmid that you have!

 

The tag sequence you have given translates to YPYDVPDY, and it looks like you have copied the ATG, the GGC and the first 24 of the HA correctly from the plasmid as analyzed by Addgene, and annotated by the depositor. If you search for this sequence you will come up with it being the epitope for anti-HA antibodies. The sequence you have used for the Kozak is correct, and your start site is in-frame with your HA tag, so I am sure that you have the correct sequence and it will work.