how to predict amplicon size? - (May/09/2018 )
dear all
I would greatly appreciate if you help me know how to predict the amplicon size in conventional PCR using the sequences of forward and reverse primers? is there a website that can provide such info?
here are the sequences of alpha-tubulin primers used:
forward: ACACCTTCTTCAGTGAGACAGG
reverse: CTCATTGTCTACCATGAAGGCAC
thanks
-yobou-
Try the primer3 site - you can put in the sequence of your gene and add the primer sequences, so I should show you where these match.
Otherwise you can align them to the sequence using any number of alignment programs and note the places they bind.
-bob1-