Protocol Online logo
Top : New Forum Archives (2009-): : -Molecular Biology-

Primer Designing - (Apr/02/2015 )

Can anyone design primers for me for IFNG interferon, gamma ? I tried to design but I couldnt desing :(

-Burak Kaan Yasdı-

what do you need exactly?

Whats the sequence of your gene?

-pito-

https://www.ensembl.org/Homo_sapiens/Transcript/Sequence_cDNA?db=core;g=ENSG00000111537;r=12:68154768-68159747;t=ENST00000229135  this is the sequence of my gene . I tried to design it for 5 hours but i couldnt do it

-Burak Kaan Yasdı-

I need forward and reverse primers for amplification of needed gene,I need to calculate the specific temperature for these primers, 

-Burak Kaan Yasdı-

What do you need the amplification for? Sequencing? Real-time detection? ...?

 

How exactly did you try to design the primers, what did you use?

-Trof-

I need these primers for PCR. Also I need to select right restriction enzymes for these primers.

First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.

-Burak Kaan Yasdı-

Burak Kaan Yasdı on Fri Apr 3 09:58:27 2015 said:

I need these primers for PCR. Also I need to select right restriction enzymes for these primers.

First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.

So if I understand it completely: you want to amplify the gene (IFNG interferon, gamma) and add restriction sites to your primers?

-pito-

Yes you understood completely.

-Burak Kaan Yasdı-

Burak Kaan Yasdı on Fri Apr 3 11:14:35 2015 said:

Yes you understood completely.

ok

 

but what RE do you want to add?

 

I'll have a look later today to tell you how to design the general primers, then you already know that.

-pito-

For the primers: since you need a specific gene there is no real "problem" here.

You simple have to use the first 18bps (or 21-24) of the gene for the forward primer + the RE (and linker) you want to add.

For the reverse: exact the same, but in the other direction.

 

Simple put, lets say this is your gene:  TTTTTTTTTGGGGGGCCCCCAAAAGGGGGCCCCCC

 

You make the forward primer: TTTTTT

Reverse: GGGGG

(but in reality 18 bps long)

 

For the RE:

 

Forward:

 

XXXX-Linker-TTTTT

(from left to right 5'-3')

 

reverse:

YYYY-linker-GGGG

(from "right to left", 5'-3')

 

 

XXX = RE

YYY= RE

 

 

I have not had time to check it more in depth with your gene , but its the same approach...

-pito-