Primer Designing - (Apr/02/2015 )
Can anyone design primers for me for IFNG interferon, gamma
what do you need exactly?
Whats the sequence of your gene?
https://www.ensembl.org/Homo_sapiens/Transcript/Sequence_cDNA?db=core;g=ENSG00000111537;r=12:68154768-68159747;t=ENST00000229135 this is the sequence of my gene . I tried to design it for 5 hours but i couldnt do it
I need forward and reverse primers for amplification of needed gene,I need to calculate the specific temperature for these primers,
What do you need the amplification for? Sequencing? Real-time detection? ...?
How exactly did you try to design the primers, what did you use?
I need these primers for PCR. Also I need to select right restriction enzymes for these primers.
First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.
Burak Kaan Yasdı on Fri Apr 3 09:58:27 2015 said:
I need these primers for PCR. Also I need to select right restriction enzymes for these primers.
First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.
So if I understand it completely: you want to amplify the gene (IFNG interferon, gamma) and add restriction sites to your primers?
Yes you understood completely.
Burak Kaan Yasdı on Fri Apr 3 11:14:35 2015 said:
Yes you understood completely.
ok
but what RE do you want to add?
I'll have a look later today to tell you how to design the general primers, then you already know that.
For the primers: since you need a specific gene there is no real "problem" here.
You simple have to use the first 18bps (or 21-24) of the gene for the forward primer + the RE (and linker) you want to add.
For the reverse: exact the same, but in the other direction.
Simple put, lets say this is your gene: TTTTTTTTTGGGGGGCCCCCAAAAGGGGGCCCCCC
You make the forward primer: TTTTTT
Reverse: GGGGG
(but in reality 18 bps long)
For the RE:
Forward:
XXXX-Linker-TTTTT
(from left to right 5'-3')
reverse:
YYYY-linker-GGGG
(from "right to left", 5'-3')
XXX = RE
YYY= RE
I have not had time to check it more in depth with your gene , but its the same approach...