pcr primer design - (Mar/10/2015 )

hi, i'm new to pcr primer designing using softwares.I want to synthesize 2 primers for a protein coding gene which is to be inserted in to pcambia vector. can anybody tell me where can I get a stepwise procedure to design primers for standard pcr using bioedit or primer3 etc?

Thank you

-mapper-

I found this one for example on google, searching for "how to use primer3".

-Trof-

TGCAGGCGCCCCGAGTGCTGC

CGTCACTAGTGTCGTCTACTA

Dear I want to know how this gentleman calculated the Tm of the F 73 and 54 for the R primers because I used the Wallace Rule it gives F 74 and R 62 C. in this case the Ta should be around 55-65.

thank you

-aldoskys-

Which gentleman exactly? In primer3 you can select Table of thermodynamic parameters and Salt correction formula depending on prefered paper. Also adjusting the salt concentrations.

But I don't adjust anything and use default values, it gives pretty good estimate for annealing temperature using the calculated Tm -4 degrees.

But what did you expect? You have one primer with 76% GC and the other one with 47 and they are of same length. And still you have too much Tm difference between primers, regardless what formula you use..

-Trof-

I have these two primers F: TCAAAGGAATGTTGGG and R: ACGCACATAGGGATTG to use in PCR. I want to know what is the Tm for the two primers in order to know what annealing temperature to be used while running the PCR.

I will be using this buffer 10X ViBuffer A (without MgCl2} 500mM KCl, 100mM Tris-HCI (PH 9.1 at 20°C) and 0.1 % Triton™ X-100. The buffer is optimized for use with 0.1-0.2mM of each dNTP. where the primers concentration is 2um.and the MgCl2 is 50mM.

Please I need some help with these two primers F: TCAAAGGAATGTTGGG and R: ACGCACATAGGGATTG . Any help is really appreciated I have calculate Tm using Wallace rule

Tm = 4(G+C) + 2(A+T) Tm Forward primer = 46 C and for Reverse =50 C. In addition to that I used online Tm calculator at

thank you very much,

Please need some help

-aldoskys-

aldoskys on Sun Mar 22 00:11:33 2015 said:

I have these two primers F: TCAAAGGAATGTTGGG and R: ACGCACATAGGGATTG to use in PCR. I want to know what is the Tm for the two primers in order to know what annealing temperature to be used while running the PCR.

I will be using this buffer 10X ViBuffer A (without MgCl2} 500mM KCl, 100mM Tris-HCI (PH 9.1 at 20°C) and 0.1 % Triton™ X-100. The buffer is optimized for use with 0.1-0.2mM of each dNTP. where the primers concentration is 2um.and the MgCl2 is 50mM.

Please I need some help with these two primers F: TCAAAGGAATGTTGGG and R: ACGCACATAGGGATTG . Any help is really appreciated I have calculate Tm using Wallace rule

Tm = 4(G+C) + 2(A+T) Tm Forward primer = 46 C and for Reverse =50 C. In addition to that I used online Tm calculator at

thank you very much,

Please need some help

Use this website to calculate/estimate the annealing temp. of your primers

http://www.basic.northwestern.edu/biotools/oligocalc.html

-Mad Researcher-

mapper on Tue Mar 10 07:02:45 2015 said:

hi, i'm new to pcr primer designing using softwares.I want to synthesize 2 primers for a protein coding gene which is to be inserted in to pcambia vector. can anybody tell me where can I get a stepwise procedure to design primers for standard pcr using bioedit or primer3 etc?

Thank you

Hi,

Maybe this would help you. Its based on primer3 plus.

bit.ly/1GQ0T5P

Cheers

-Mad Researcher-