Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Cloning

confusing with where to put primers and which ordination - (Sep/10/2014 )

Dear All may be easy but I really confusing. Please answer my questions

1- If we want to amplify a pice of DNA the left side primer should be:

a-same as sequence

b- complementary to the sequence

c- reverse complementary

the right side should be

a-same as sequence

b- complementary to the sequence

c- reverse complementary

 

2- for mutation primers they should be of course

a-same as sequence

b- complementary to the sequence

c- reverse complementary

Thank you in advance

-RNA woman-

These look suspiciously like homework questions.

 

For 1 f you think about how the DNA gets copied, that should tell you which of  your options are correct.

 

For 2, none of the above. Where do you want the mutation introduced?

-bob1-

Hi bob1, No it is not home work I really confused,

for Question two of course all are the answers after changing the triply codon. 

for example

K21

aaaattcccgtcgctatcaaggaattaagagaagcaacatctccgaaag

 

K21A

 Forward: CGCTATCGCAGAATTAAGAGAAGCAAC

Reverse: GTTGCTTCTCTTAATTCTGCGATAGCG

 

D83

Tcgcttggtgcaccgcgacctggcagccaggaacgtactggtgaaaac

 

D83A

 Forward: GCTATCGCAGAATTAAGAGAAGCAACA

Reverse: GCTATCGCAGAATTAAGAGAAGCAACA

Are corret primers?

-RNA woman-

Ah, so using qickchange system for the mutagenesis then. If so, the K21 primers look OK, you may want the mutation to be more in the centre of the primers though.

 

for D83 you have given the same forward and reverse primer...

 

Anyway, for 1, the forward primer is the same as the sequence, and the reverse is the reverse complement.

-bob1-

Thanks bob1

-RNA woman-