Rxn not working - amplify/linearize plasmid - (Apr/09/2014 )
I've tried this reaction several times over the past few weeks and tried a few trouble shooting things, but still not working. My coworker got it to work before me, I'm using his primers.
Mix together:
0.5uL F primer (final conc 500nM/uL)
0.5uL R primer (final conc 500nM/uL)
1uL template DNA (final amount 5ng) (I'm amplifying 3 different plasmids that have the same primers)
3uL water
5uL Q5 Master Mix (NEB)
Primers:
CCCCTGTAGAAATAATTTTGTTTAACTTTA ATTTCCTAATGCAGGAGTCG
I've tried the following:
- Varying the amount of primer higher and lower than standard 500nM/uL
- Varying the amount of template plasmid to 1pg, 500pg, 1ng, 5ng, 100ng
- Re-amplifying plasmid in e coli, miniprepping to make new plasmid concentration
- Borrowed plasmid from my colleague who had successfully amplified from his tube, repeated his procedure exactly with no change
- New water
- New Q5 Master Mix tube
- New primer stock
- Longer extension time (40s/kbp) and regular extension time (25s/kbp)
- 25 cycles and also 30 cycles
- Double checked the primers match to the sequence
- Used Tm specified by NEB Tm calculator, my colleague got product using this Tm
EVERY SINGLE TIME there is NO product at all, none visible, nope. I can see my DNA ladder and also a faint primer band that varies depending on how much primer I add. When I used a large amount of template I could see a faint plasmid DNA band at the top, but there was no linearized DNA band visible.
Any insight would be greatly appreciated! I've been cloning for a few years and this is bugging me.
I was thinking of:
- Ordering new primers
But I don't have any other ideas. I would change the Tm but my coworker got product already.
Get in some fresh primers - the fact that you used a co-worker's plasmid which worked for him recently indicates that there is something wrong with the reaction. You tried new mastermix, so the only option is primers...
I don't know what the program is suggesting for Tm with those primers, but the first one has very low GC content at the 3' end. The four C's at the 5' end is also problematic. I would be trying to redesign this primer to extend the region matching your substrate to include one or two 3' G's or C's. And replace the CCCC with a more mixed set of bases, since you don't care what they are.
Meanwhile, lower the annealing temperature (and perhaps also the extension temperature). An extension temperature of 72 with very low 3' GC will sometimes not extend well. Try 68 instead of 72 extension. You may be calculating your Tm on the entire primer, rather than on the part which binds the template. This is wrong (at least for the first few cycles) and can lead to failure.
phage434 on Thu Apr 10 15:39:13 2014 said:
I don't know what the program is suggesting for Tm with those primers, but the first one has very low GC content at the 3' end. The four C's at the 5' end is also problematic. I would be trying to redesign this primer to extend the region matching your substrate to include one or two 3' G's or C's. And replace the CCCC with a more mixed set of bases, since you don't care what they are.
Meanwhile, lower the annealing temperature (and perhaps also the extension temperature). An extension temperature of 72 with very low 3' GC will sometimes not extend well. Try 68 instead of 72 extension. You may be calculating your Tm on the entire primer, rather than on the part which binds the template. This is wrong (at least for the first few cycles) and can lead to failure.
The primers have 100% overlap with the template sequence actually. I'm amplifying the plasmid for Gibson assembly with a primer I ordered that contains overlaps to match the plasmid.
I suppose I'll try varying temps. My coworker is going to try it again to see if he can repeat his success.