Please comment on my Cloning Plan - (Mar/07/2014 )
Hello all,
I am creating a fluorescent reporter plasmid to study the activity of my target promoter via levels of fluorescent proteins (FP). I want to make sure that the insert is designed and inserted properly so that everything is "in-frame" and FP expression will occur under promoter activity. I will explain my plan and my thinking process so that those of you with more experience in cloning can give me feedback on the feasibility of my goal (getting FP expression from the promoter).
I have a reporter plasmid which includes a region that has a MCS upstream of a FP gene.
The downstream end of my promoter insert is as follows:
...CCATCGGAAACCGCATCCATGCTCCCGACCTGCCGCTTCGGTCGGTATCGACCTTGCCGCGTAGGCTGGGCATGCGGTTCAGCAAGAAAGGACTAGT
The primer I will use to amplify the promoter (blue) will attach a SpeI restriction site at the downstream end (shown above in black).
The sequence around the SpeI site on the vector is as follows:
GCCTAGATAGATAGAGAGAGAGAGAGACTAGTGGAGGAAGAAAAAATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA...
The green portion is the MCS with the FP gene in red and the SpeI site in black.
After digestion and ligation this portion of the recombinant plasmid should look as follows:
...CCATCGGAAACCGCATCCATGCTCCCGACCTGCCGCTTCGGTCGGTATCGACCTTGCCGCGTAGGCTGGGCATGCGGTTCAGCAAGAAAGGACTAGTGGAGGAAGAAAAAATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA...
At this point I want to consider the transcription and translation steps. I will assume that the promoter works fine and transcription will occur normally as in the wild type context. The promoter insert I am using includes on the downstream end the first 20 or so nucleotides of the gene which it normally expresses, marked off in the following in brackets.
...CCATCGGAAACCGCATCCATGCTCCCGACCTGCCGCTTCGGTCGGTATCGACCTTGCCGCGTAGGCTGGGC
Therefore I will say the transcription occurs normally up to and past the ATG and continues on for the whole FP gene.
Thus with this transcript I want to identify where the ribosome will bind and where the reading frame will begin to make sure that the promoter insert and FP gene are in frame. According to literature (http://www.pnas.org/content/86/1/129.full.pdf) the ribosome binds to a sequence called the Shine Dalgarno sequence which is located 5-8bp upstream of the initiation codon and contains an AGG sequence. Because my promoter insert contains part of the coding gene, there are two possible RBS and two ATG's - one set for the coding gene fragment and the other for the vector's FP gene:
...CCATCGGAAACCGCATCCATGCTCCCGACCTGCCGCTTCGGTCGGTATCGACCTTGCCGCGT*AGG*CTGGGC<ATG>CGGTTCAGCAAGAAAGGACTAGTGG*AGG*AAGAAAAA<ATG>GCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA...
If the ribosome binds to the SD sequence of the FP gene then no concern over frame shift is needed; however, if the ribosome binds to the SD sequence of the coding gene fragment then the reading frame must be checked to ensure proper translation of the FP gene.
The reading frame and amino acid analysis of translation initiation from the coding gene fragment is as follows:
...CCATCGGAAACCGCATCCATGCTCCCGACCTGCCGCTTCGGTCGGTATCGACCTTGCCGCGT*AGG*CTGGGC<ATG>(M)CGG(R)TTC(F)AGC(S)AAG(K)AAA(K)GGA(G)CTA(L)GTG(V)GAG(E)GAA(E)GAA(E)AAA(K)<ATG>(M)GCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA...
This shows that the FP gene is in frame with the promoter and that there is no unexpected stop codons between the promoter and the FP gene and I can assume that the FP gene will be expressed without any surprises.
So with that in my opinion this is a complete check of my cloning plan and that FP expression should occur given the promoter is active and the actual recombinant plasmid sequence matches the theoretical.
I am still learning the ropes of cloning so I would appreciate very much if anyone with more experience can share with me additional insights and confirm or deny that the plan will work.
Thank you,
Ted
It looks like a very well thought out plan. Just make sure you design you primers with enough overhang for proper enzyme digestion.
Everything else you listed looks correct. Good Luck!