who else can help me check primer. im a little bit less confident :(( - (Jan/08/2014 )

This is my sequence ((357bp) i got from genebank. 

ATGGAGATCTTCCGGGAGTTCACCTTCGAGGCCGCGCACCGGCTGCCGAACGTGCCCGAGGGGCACAAGTGCGCCCGGCTGCACGGTCACTCGTACCGGGTGACGGTGCACGTCAGCGGCGACGTCGACCCGCACAGCGGCTGGGTGATGGACTTCGGCGACCTCAAGAAGGCGGTCGAGCCGATCCGCGACCGGCTCGACCACCACTACCTGAACGAGGTGCCGGGGCTGGAGAACCCGACCAGCGAAGTGCTGGCCCGCTGGATCTGGGACCGGCTGGCCGGGTCGCTGCCGCTGTCGGCGGTGGGAGTCCGGGAGACCTGCACCTCTGGCTGCGTCTACCGCGGCGACCGCTGA.

With Restriction Enzyme : BamHI( up stream)  and HindIII ( downstream)

1.      Forward primer  with BamHI

 GGATCCTGATGGAGATCTTCCGGGAGTTC (Tm= 62^oC)

2.      Reverse primer  with HindIII

GTCTACCGCGGCGACCGCTGA

Complement: AAGCTTTCAGCGGTCGCCGCGGTAGAC  (Tm= 67^oC) 

thanks in advance 

Have a nice day

You need 4-6 bases 5' of the restriction site if you plan on cutting with those restriction enzymes. They won't bind and cut DNA when the recognition site is at the very end of a dsDNA fragment. It doesn't matter what the bases are. I know it's a popular choice, but I would avoid BamHI, since it can't  be heat killed.

so, u mean, with BamHI, i could  not do  ligate or digest? last topic i also mentioned about my gene with RE: bamHI and HIndIII. i ligated into pet28a(+) but not successful. :((

im verry dissapoint now :((

You can use BamHI, but since it cannot be heat killed, you will need to gel purify your restriction digests prior to ligation. This will take care of the BamHI and you will be able to do a normal ligation.

Right. But as others in the forum already are aware, I hate gel purification and will do most anything to avoid it.

Seconding the hate of gel purification.

i also hate gel purification. so, should i design primer again or still using and keep going on?

And 1 thing is after BamHI i put two more nucleotides in foward primer. is it possible to Protein translation? any problem? i put 2 nucleotides because i counted from RBS in pET28  1 codon each, till BamHI, so it remaining 1 nucleotide so i put 2 more nucleotides to make 1 codon (3aa) and afterwards is ATG is start codon. 

is anyone can help me check that problem?

Those extra nucleotides dont matter. Translation simply starts at that first ATG, regardless of whether it is in frame downstream of the RBS. "in-frame" only applies to sequences AFTER the first ATG.

thank HOYAJM so much.

but another thing , you said to me :  "You can use BamHI, but since it cannot be heat killed" . so could you explain more detail about that for me?

Heat killing enzymes is convenient and allows you (often) to avoid a purification step -- you digest, heat kill, and go directly to ligation. But you can always do a purification instead, and will have to with BamHI digestions. This is most important for preparing PCR'd inserts. Vectors often need to be separated from inserts by gel purification, although other options (such as preparing the vector with PCR, or vectors containing inserts than can be counterselected) can be used. One of my favored cloning techniques is PCR of both the vector and insert with enzymes that can be heat killed, followed by ligation and transformation. The template for the vector and insert PCR reaction can usually be eliminated by using very low concentrations, and by treating the PCR products (after purification) with the two restriction enzymes chosen plus DpnI.