Sequencing of ~3,5 kb - (Dec/28/2013 )
Hello,
i would linke to sequence the whole rpoB gene. But how can I do it?
Should I divide the gene into smaller regions, do pcr and sequencing separately?
For example Khamis, Raoult and La Scola (2004) have a set of primers for rpoB.
How can I now select the best primers for my purpose? I thought about following pairs:
1) C35F and C1415F
2) C890F and C2130R
3) C1415F and C2700R
4) C2130F and C3490R
5) C2625F and C3490R
For sequencing I am planing to only use the forward primers.
Please let me know your suggestions. Many thanks!
what method are you using to sequence?
if next gen then you will make a library, run and construct your gene (i'm not fully versed on ngs so i can't give more detail).
if sanger sequencing then you can primer-walk (use several primers which will give overlapping sequence for you to construct the gene.
Hello,
it is Sanger sequencing. Then, I will use overlapping sequences. I am planning to use the following primers:
C35F
GGAAGGACCCATCTTGGCAGT
C1415R
GVGTGATGCCKGCRTACAC
C820F
CCYGCRACGAACGCCATCT
C2130R
GTGGCCYTCCCAHGGCATGAA
C1415F
CBCACTACGGMCGYATGTG
C2700R
GCWTACTTGTARCCVGTCCA
C1415F
CBCACTACGGMCGYATGTG
C2700R
GCWTACTTGTARCCVGTCCA
C2625F
AGATCCARGAYGGCGAYAAG
C3490R
GCWTACTTGTARCCVGTCCA
Could you please help with primer quality estimation (information about whether dimers or secondary structures will be formed)?
I used 'Primer List' program on this web page: http://primerdigital.com/tools/
Unfortunately, because I am not sufficiently experienced, I cannot draw the conclusion.
since you are sequencing you won't have to worry about dimers, you use only one primer in each reaction.
there are a number of primer design tools available online (you can google them) or you can use the primers that were already designed and walk from both ends.
Hi. Im also planning to use the overlapping sequences to sequence a 20 kb length product.
Say if I have 20 primer sets for that with 150 bp overlapping. What would be the more appropriate way to prepare my sample for sequencing?
Do I need to optimize all the primer sets?
Angeline on Thu Jan 16 12:12:58 2014 said:
Hi. Im also planning to use the overlapping sequences to sequence a 20 kb length product.
Say if I have 20 primer sets for that with 150 bp overlapping. What would be the more appropriate way to prepare my sample for sequencing?
Do I need to optimize all the primer sets?
when sequencing you don't use primer "sets". you use only one primer in each reaction. a "reverse" primer can be used in a separate reaction to sequence from the other end and/or to confirm the results of the "forward" primer.
I see.
If my initial sample is in RNA form, then I have to convert them to cDNA. After that, I can sequence directly using the cDNA as template and the forward primers?
You would normally need to amplify the cDNA by PCR prior to sequencing. The primers used for PCR will determine which RNA (really cDNA) is amplified and then sequenced. You'll need primer pairs for the PCR, but after the PCR and product purification, you will sequence with only one of those primers (or with both in separate reactions).
Thanks for the reply.
In that case, I have to have another primer pairs for the PCR? For the PCR, do I need to amplify the whole 20kb lenght?
You can use the one of the PCR primers in a sequencing reaction, so no, you need only the PCR primers.
You don't need to PCR the entire cDNA (it would be difficult in any case -- normally the cDNAs are shorter than that, since the RT reaction has difficulty with long transcripts).