Protocol Online logo
Top : New Forum Archives (2009-): : DNA Methylation and Epigenetics

primer checking & restriction enzyme based methylation specific polymerase c - (Dec/24/2013 )

Dear doctor,

I want to check a primer sequence in promoter area of two genes for methylaion analysis:

BRCA1 gene:

forward:

5' TTGGGAGGGGGCTCGGGCAT 3'

Reverse:

5' CAGAGCTGGCAGCGGACGGT 3'

17-Beta Hydroxysteroid dehydrogenase type 1:

Forward:

5'AGACCATCCTCACCAACAGG 3'

Reverse:

5'CCTGGCCCTGTCATTTTTAG 3'

 

I tried to find them in blast and ensembl, but :

in blast I found but I donot know their position in promoter or not

in ensemble:

I found the forward only( BRCA-1 in area not exon may promoter???) ( in 2nd gene in exon)

please tell me " Is that primers right or not and to do they donot give the result I want in methylation analysis using resriction enzyme?"

If that primer is wrong, so what is the solution?

thanks alot 

-whitehorse25-

Places of primers:

 

http://i42.tinypic.com/mt40na.jpg

 

These are not good primers

 

http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=357590723&org=Human&db=hg19&wp_target=hg19Kgv14&wp_f=TTGGGAGGGGGCTCGGGCAT+&wp_r=CAGAGCTGGCAGCGGACGGT+&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0

 

 

http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=357590723&org=Human&db=hg19&wp_target=hg19Kgv14&wp_f=AGACCATCCTCACCAACAGG+&wp_r=CCTGGCCCTGTCATTTTTAG+&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0

-memari-

sorry I made a mistake:

 

this is the results of primer blast

 

http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=357594447&org=Human&db=hg19&wp_target=genome&wp_f=TTGGGAGGGGGCTCGGGCAT+&wp_r=CAGAGCTGGCAGCGGACGGT+&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0

 

http://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=357594447&org=Human&db=hg19&wp_target=genome&wp_f=AGACCATCCTCACCAACAGG+&wp_r=CCTGGCCCTGTCATTTTTAG+&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0

-memari-

thank you for your reply

but:

these primer in promoter area or not?

why they are bad primers?

should I put these melting temp in pcr or what is written in a paper?

can BRCA1 gene primer be present in mRNA transcript variant for giving DNA band required in PCR?

-whitehorse25-

Dear doctor,

I want to check a primer sequence in human promoter area of two genes:

*BRCA1 gene:

forward:

5' TTGGGAGGGGGCTCGGGCAT 3'

Reverse:

5' CAGAGCTGGCAGCGGACGGT 3'

 

*17-Beta Hydroxysteroid dehydrogenase type 1:

Forward:

5'AGACCATCCTCACCAACAGG 3'

Reverse:

5'CCTGGCCCTGTCATTTTTAG 3'

 

I tried to find them in blast and ensembl, but :

in blast I found but I donot know their position in promoter or not

in ensemble:

I found the forward only( BRCA-1 in area not exon may promoter???) and (  2nd gene in exon)

please tell me " Is that primers right or not 

If that primer is wrong, so what is the solution?

these primer position in promoter area of that gene or not?

thanks alot 

-whitehorse25-

I told you. I made a mastake.

 

they are good.

Marker1 and 2  are in promotor of BRCA1.

 

 

http://i42.tinypic.com/mt40na.jpg

-memari-

Only post your topic once in its respective section. Each topic will get a considerable amount of view's when users check "view new content." 

-jerryshelly1-

I usually use the BLAT tool at UCSC Genome Browser, but it appears to be offline at this time.

-jerryshelly1-

Hi WhiteHorse, 

 

I checked your primer sequences in UCSC's In silico PCR and the BRCA primers seem to be located after the gene. While the HSD17B primers are upstream of the gene, it is difficult to say that the region is the promoter region. You would have to look up some literature or do some experiments to prove that the region you are targeting is indeed the promoter. 

 

You can also see this for yourself, if you use this link.

 

Ameya

-Ameya P-