BLAST sequence analysis and gene identification - (Dec/09/2013 )

Hi,

I need to identify the gene/ suggest the function. I've been given a DNA sequence and I have to use BLAST (blastn). What I did so far (using the ncbi blast): i chose nucleotide blast program to run, entered my sequence, chose Others (nucleotide collection nr/nt) database and in the program selection part I picked Optimize for somewhat similar sequences (blastn). I got 100 hits. And now I'm unsure which one is the gene I'm looking for- the first hit? How do I determine so (the lowest e value, the highest ident, query cover)? I reckon it's triosephosphate isomerase...

I'd really appreciate your help, as I completely do not understand this programme and I have no idea what I'm doing but I do have find out the structure and function of a given sequence. If anyone could make that clear for me, would be forever in your debt.

This is the sequence:

GCAACGCCAGGACAAAAAAAAAAAAAAAAAAAAAGACAGGGTGGAATTAGCAGTACACTGCTCAAATGCT

GATCAGAACATAAACAGAGGTCGTGATCGCCCCTCCCGCTCTCTACCTTGACTTCGTCAAGCAGAACCTC

CAGAAGCCCAACGTTGAGGTTGCCGCTCAGAACGTCTTCAACAAGCCCAACGGCGCCTTCACCGGCGAGA

TCAGCGCCACGCAGCTCCTGGATCTCGGCGTCAAGTGGGTCATTCTCGGCCACTCTGAGCGCCGCAACGA

GCTCGGCGAGTCGGACGAGTTCATTGCCTCCAAGACCAAGTACGCCCTCGACAACGGCATCTCGGTCATC

TGGTGCTGCGGCGAGTCCAAGGACACGCGCCAGGCCGGCGAGACCATCAAGTTCGTCGAGAACCAGCTCG

CCGCTCTCGCCAAGGAGATCAACGACTGGAAGAACGTCGTTATCGCGTACGAGCCCATCTGGGCCATTGG

CACCGGCCTCGTCGCCACCAAGGAGCAGGCCCAGGAGGTGCACGCCGCCATCCGCAGCTGGCTCAAGCAG

AACGTCAGCGACAAGGTTGCTGAGGAGACCCGCATCCTCTACGGTGGCTCTGTCAACGCCAAGAACTGCA

AGGACCTTGCCAAGGAGCAGGACATTGACGGTTTCCTTGTTGGCGGTGCCAGCTTGAAGCCCGAGTGTAA

The first result you get has 100% identity = same sequence, so not much to think if you have a single perfect match. That's your gene

to start with your guess is right ., triosephosphate isomerase is your gene.

from my understanding this programme basically works like a google search and based on your query it brings the most closely resembling search first and in the descending similarity further. ideally the first one should be your gene/protein or whatever you are looking for. in research sometimes when you find the new sequence for something, it would show simialrity to one or more genes, then you hypothesize that your new gene might be similar to that already known genes but may have integrated function of both genes. this is just an example of how this is useful further. no as far function is concerned, since this is a 100 percent match its basically the function of the protein triosephosphate isomerase - the reaction it executes and its physiological significance. structure is a question of what, you can have mrna structure, gene regulation structure, protein and its primary , secondary or tertiary strucure. to find them, i would say simply put the words together and google it, you should have the answer. for ex, triosephosphate isomerase protein secondary structure if thats what you want to find.

good luck.