Ligation of PCR fragments - (Sep/22/2013 )

Hi there, i need experts help for my experiment.

 

I need to ligate 3 pcr fragments, and clone them into a vector.

 

So i have fragment A, 500bp, fragment B, 800bp and fragment C, 489 bp

 

i need them to be in this arrangement

 

A---B---C

 

PCR of all the fragments have no problems at all.

 

Next, i start with the ligation of A to B

 

SacI---A---EcoR1

EcoR1---B---Spe1

 

I column purified them after PCR, and digest them in EcoR1, overnight.

Column purified them again, and ligate them overnight.

i diluted them 100X, and run PCR with Forward primer of A and Reverse primer of B

 

And i get a nice band at 1300bp.

 

Next, i column purified AB, digest AB and C with Spe1 overnight, column purified and finally ligate them. Same as what i did for AB.

 

Here where the problems come....

 

all i get is smearing, a bright smearing originated from the well.

 

But i did see a band near to 2000bp (my expected band)

 

So i proceed with gel extraction, cloning and transformation, but didnt get any colony at all (did it 3 times)

 

My boss said that i cannot gel extraction it , because the band is too smearing.

 

He asked me to ligate again, and run the ligation mixture in gel, and visualize them.

 

But all i can see is smearing, can someone tell me what happen here? i thought i should see bands.

 

Anyway, i start again my ligation, using new ligase, new ddH2O, new diluted primers, did a new pcr of ABC, and the smearing is gone but the band which i had seen at 2Kb is now disappear along with the smears. All i got is a bands at 500bp, 800bp and some bands under 1000bp.

 

What happen here?

 

My hypothesis is, i have a contamination is one of my ligation ingredients, and it seems that my digestion of AB and C is not complete. The bands i saw is just ligation of C with C...

 

I start a new digestion of AB and C and will ligate them and pcr them tomorrow, 

 

 

 

can someone help me?

Do you have 5' overhangs past the SpeI site on your primers?

I have..

 

For fragment B

AAAAAAAACTAGTCCCCGAAAAGTGCCACCT

 

 

For fragment C

TTTTTTACTAGTGGTTCCAGGGTCAGCTCG

 

 

So it will look like this,

 

A---B--TGATCAAAAAAAA----TTTTTTACTAGT---C

Did you check how your SpeI work? May be overnight is too long for SpeI, 

Try to cut with SpeI for 2-3 hours and than ligate the same amounts of the fragments. 

The primers look fine, but your last diagram is very wrong. The primer attached to B is (should be) the reverse complement, not the reverse. This is probably not your problem, but you should certainly understand why this is true. The figure should be:

 

A---B--ACTAGTTTTTTTTT----TTTTTTACTAGT---C

 

After ligation, do you amplify your ligation product with forward primers to A and reverse primers to C?

Is there a product?

Hi there,

 

thank u for ur replies. 

 

@julianak77

i know my speI work because i tested it with my vector, plus that RE just arrived the day before.

 

@phage434  

sorry for the wrong diagram, had a long day when i did that diagram :)

Yes, i did amplify my ligation product using Forward A and Reverse C.

There is a band at the right size, but it comes with a thick smearing.

I manage to get the smearing disappear, as it turns out there is contamination in either my ligase,buffer,DNTP or ddH2O, unfortunately the band also disappear                           with the smearing. 

 

Now things are getting even weirder, i tried to amplify again my A---B, bu i cannot, it seems the product is degrading. 

Maybe there is Dnase in my sample??

So now i need to restart whole over again, will try to amplify A, B and C tomorrow.....

I think you are doing too many purifications. I would purify the PCR products, (run a gel to check they are there and the right length) then mix them and cut with both EcoRI and SpeI simiultaneously. Heat kill  both enzymes, then ligate. PCR with the outermost primers.

 

With either strategy, you have to expect many side products. A can bind to A or B. B can bind to B or C. So you could end up with products like this:

 

A-B-C

A-B-B-A

A-A

B-B

A-B-C-C-B

Yeah, i think i purified too much, losing a lot of products in the process.

May i know whether heat inactivation is sufficient enough?

And after i heat kill them, can i just put ligase directly to the tube? or i need to add ligase buffer? 

How bout the salts and short nucleotide, which has been cut by the Res.

Heat killing enzymes works very well, leaving the DNA in your RE buffer. Often this can be directly used in ligation, either by using small amounts in a T4 ligase buffer reaction, or by adding ATP to the unpurified DNA (the RE buffer is an acceptable ligation buffer, except for needing some ATP in the reaction).

When you amplify your fragments with primers A and C . How much DNA you put into the reaction?