transcript variant X - (Sep/19/2013 )
Hello
Do you know what is the meaning of transcript variant X?
Some genes have transcript variant X.
In what context? Usually X implies an unknown in mathematics, but I suspect in this case they are referring to a known variant that they have called "X" in the paper you are reading.
I have seen it a lot during Primer Designing:
Lets check a pair of primers for ACTB:
Goto
http://www.ncbi.nlm.nih.gov/tools/primer-blast/
Copy and Past these primers there:
CACCATTGGCAATGAGCGGTTC
AGGTCTTTGCGGATGTCCACGT
Then click on "Get Primer". Now you see this link:
Which has these links below:
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=530384922
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=530384920
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=530384918
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=316659408
http://www.ncbi.nlm.nih.gov/books/NBK50679/#RefSeqFAQ.what_is_the_difference_betwe_1
There is really little information about the nomenclature of "transcript variant Xn" on NCBI site. I guess they represent variants of all model mRNA (predicted mRNAs) refseqs. In the example of ACTB, there are 3 model RefSeqs (XM_005249819.1, XM_005249820.1, and XM_005249818.1), corresponding to transcript variant X1, X2 and X3. So from this example, it is clear to me that "transcription x" is one of the model RefSeqs for a particular gene.
The link given by Bob above tells the differences between model refseq (XM_xxxxxxxx) and experimentally derived refseq (NM_xxxxxxx).
pcrman: I thought that was the difference between the X variants and other sequences - they were predicted rather than experimental - could easily be wrong though, don't need to use the NCBI database to that extent very often, so still learning myself.