PCR of GC-rich sequence (E-cadherin) - (Jul/11/2013 )

I am working with the promoter of E-cadherin during the last months analyzing the effect of different matix on methylation patterns. I am trying to optimize the PCR amplification conditions and I have noticed that I can only amplify non-methylated sequences (I work with controls: completely methylated and unmethylatde from Qiagen). I have been trying to change different parameters of the PCR:
- Protocol from normal one to slowdown PCR
- Mg concentration from 1,5 to 3 mM
- Polymerase without hot start or without
- Use of PCRx Enhancer solution from life tech (using this buffer it was possible to start amplifying samples without methylation)
- Amplify long (321bp) and short (172bp) sequences.
- Primer quantity from 0.2mM to 1.2mM

Right now I have no more ideas and I would like to ask you for some advice. Does someone work with this promoter and can give me some new directions?

Thanks you very much in advance

Hello,

were you primers designed to amplify both methylated and un-methylated seq?

Yes I designed primers within the zone without CpG islands with the aim that the same primers can amplificate both sequences.

when you bisulfite convert the sequence, it is no longer GC rich, instead GC depleted.

So, you are doing bisulfite sequencing PCR, right? How do your PCR cycling conditions look like? Can you post your primer sequences? Is the unmethylated DNA from Qiagen also bisulfite modified?

Well I have no problems with the demethylated sequence which is not longer CG rich, but I have problems with the methylated one that mantains the CG sites (I know that the other C are converted to U and then T when amplified)

So, yes, I am doing bisulfite sequencing PCR.
1. I have tried different PCR protocols. Firstly a normal PCR about 50 cycles with 30 sec of denaturing, annealing and extension. Then I have tried to develop two different PCR protocols from these articles: Russell P. Darst et al 2010 and Ulrich H Frey et al 2008. The first one increase the times of denaturing,annealing and extension during the cycles and the second one defines a slowdown PCR.
2. The primers I mostly uses (the ones that have amplified the unmethylated sequence): f GTA ATT TTA GGT TAG AGG GTT AT, r CTCCAAAAACCCATAACTAAC
3. The control samples (methylated and unmethylated) are both bisulfite treated.

Since you can amplify unmethylated DNA, your primers are doing fine and you may need to tweak your annealing temperature. In addition, if you run 50 cycle, you may need to supplement Taq during the run. I prefer two rounds of PCR: 40 cycle of first run, 25-30 cycle of 2nd run.

Thanks you very much for your advice. I will continue working on it!!