I need help for designing a pair of primers for this sequence. - (Jan/18/2013 )
I need help for designing a pair of primers for this sequence.
My Protein of interest binds to /cagagtggcctcaaactc/ and I want a pair of primers for Chromatin immunoprecipitation-qPCR for this sequence below.
I have used Softwares (Oligo, DNAstar) and online sites like NCBI and Primer3 (Plus) to automaticly find primers for me, but whenever I check them in https://www.ncbi.nlm.nih.gov/tools/primer-blast/
They bind to more than one places. I do not have too knowledge to choose primers manually.
Could you help me?
AGGAGTTCCAGGCTGTAGTGAACCATGATTGCACCATTGCATTCCAGCCTGTGTGACACAGCGAGACCC
TGTCTTTTTTCTTTTTTTTTTTGAGACAGGGTCTCGCTCTGTCATCCAGGCTAGAGTGCAGCGGTGTTT
TTCTGCTCACTGCAGCCTCAACCTGCACATTTTTTGTAGAGACGGTGTCTTGCTATGTTGCC/cagagt
ggcctcaaactc/CTGGGCTCAAGAGATCTTTCCACCTCAGCCTTCCAAAGTGCTGGGACTACAGGCGT
GAGCTACCGCGCCCAACAAAGACCCTGTCTTAAAAAGAAAACAAAAATAAACAACTCCCTCAAGTCTTT
TTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCCAGGCTGGAGGGCAGTGGCGCAATCTTGGCTCAC
TGCAAG
Thanks
They will "bind" at more than one places in PrimerBlast almost everytime. It's important to decide if they don't bint too tight compared to your target sequence. For example one or two mismatches near 3' of primer means primer won't amplify at all almost surely. Also if only one of the primer pair doesn't bind enough, there will be no product from that pairing. Also look if those matches are in organism you are using and are in genomic sequence only (since you won't have RNA in CHIP). Also product longer than certain length doesn't interest you, because they won't amplify at your conditions (can be set in prefs too), usually longer than 1500-2000 don't even count.
Filter out all those and select the best primer pair from those you designed.
