Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Biology

T7 promoter ending; to add or not to add GGG - (Dec/04/2012 )

Hi,

The sequence of T7 promoter in most plasmids is TAATACGACTCACTATAGGG, and all T7 universal forward primers end with GGG. I believe the promoter itself ends with TATA. So addition of GGG is for better transcription.

Now, I am working on a virus that only assembles itself if it follows the rule of 6, meaning the genome size must be either 15186, 15192 or 15198 bases. I need to add a T7 promoter right before the genome start, and clone this into a transcription vector. What I have noticed is that some articles don't have the GGG after TATA. Others only have 2 Gs instead of 3 Gs and this is confusing.

I think I'm just gonna omit GGG. Since my genome starts with ACC..., and T7 polymerase initiates right after TATA, then presence of an A instead of G should not be a major problem. This way I won't disturb the rule of 6 with addition of GGG.

Do you agree?

-Curtis-

May be you need to consider adding GGGAGA (highest product yields if the first 6 nucs are GGGAGA) after TATA.

see
http://www.protocol-online.org/biology-forums/posts/25892.html

P.S.- just interpreting based on link in forum, refer to more literature.

-prabhubct-

good point, thanks

-Curtis-