Bisulfite PCR Question - (Sep/24/2012 )
Hi,
I've been using this forum quite extensively in the past few months to try to figure out BSP but now I have hit a roadblock...I have been trying to amplify part of a CpG island in a gene and it had worked initially, albeit not too well, but I was still able to get some sort of band. I used MethylNick's protocol and was able to get a band but when we Sanger sequenced it, there were a lot of erroneous reads and many G's that did not match at all to the template sequence. We tried to use a regular PCR protocol (standard, 30s denat, 30s, anneal and 1 min elongate) and was able to get a good band for a while. Much stronger and very straight forward. However, lately, in the past few weeks, I am unable to get this band again. Instead, I have some laddering that could be primer dimerization (?) amplifying on itself and it does not correspond with the product size at all. I have tried to make a new working solution of primers, new bisulfite DNA, Taq has recently been bought but nothing worked. I'm still getting this laddering effect for all of my samples. I am using 5% DMSO and Qiagen Hotstar Taq as well after bisulfite conversion with Epitect.
Original sequence:
GGCGGAGGCGCAGGCGGTGGCGAGTGGGTGAGTGAGGAGGCGGCATCCTGGCGGGTGGCTGTTTGGGGTTCGGCTGCCGGGAAGAGGCGCGGGTAGAAGCGGGGGCTCTC
CTCAGAGCTCGACGCATTTTTACTTTCCCTCTCATTTCTCTGACCGAAGCTGGGTGTCGGGCTTTCGCCTCTAGCGACTGGTGGAATTGCCTGCATCCGGGCCCCGGGCTTCCCG
GCGGCGGCGGCGGCGGCGGCGGCGCAGGGACAAGGGATGGGGATCTGGCCTCTTCCTTGCTTTCCCGCCCTCAGTACCCGAGCTGTCTCCTTCCCGGGGACCCGCTGGGAGC
GCTGCCGCTGCGGGCTCGAGAAAAGGGAGCCTCGGGTACTGAGAGGCCT CGCCTGGGGGAAGGCCGGAGG
Bisulfite treated sequence:
GGTGGAGGTGTAGGTGGTGGTGAGTGGGTGAGTGAGGAGGTGGTATTTTGGTGGGTGGTTGTTTGGGGTTTGGTTGTTGGGAAGAGGTGTGGGTAGAAGTGGGGGTTTTTT
TTAGAGTTTGATGTATTTTTATTTTTTTTTTTATTTTTTTGATTGAAGTTGGGTGTTGGGTTTTTGTTTTTAGTGATTGGTGGAATTGTTTGTATTTGGGTTTTGGGTTTTTTG
GTGGTGGTGGTGGTGGTGGTGGTGTAGGGATAAGGGATGGGGATTTGGTTTTTTTTTTGTTTTTTTGTTTTTAGTATTTGAGTTGTTTTTTTTTTGGGGATTTGTTGGGAGT
GTTGTTGTTGTGGGTTTGAGAAAAGGGAGTTTTGGGTATTGAGAGGTTT TGTTTGGGGGAAGGTTGGAGGGTGGGTGGTGT
Forward primer:
GTGAGTGAGGAGGTGGTATTTT
Reverse primer:
AAACCTCTCAATACCCAAAACT
Any help would be greatly appreciated! Thank you so much!!
-molecnewb
Your Primer design is bad. There should be no CpG sites in your forward or reverse primers.
Hi paulcross,
Thank you for your response. Do you have any potential primer suggestions that would help amplify a portion of this sequence by any chance? We weren't able to find any primers that didn't have any CpG sites in between. Because of this, we used degenerate primers to amplify this sequence.
Thank you and I appreciate any other advice.
molecnewb
