Good melting curve but non-specific products appeared - (Sep/20/2012 )
Dear all,
I am a newbie in running qPCR and I am encountering some problems, especially after running qPCR can get a nice melt curve but more than one band appeared on 1.5% agarose gel (120V for 45min).
I designed the primer sets (Tm = 60oC) for the gene called p47phox with specific PCR product size of 194bp using Primer 3 Plus software. The sequence of forward and reverse primers is as below:
Forward primer - AGTCCTGACGAGACGGAAGA (length = 20)
Reverse primer - TACATGGACGGGAAGTAGCC (length = 20)
So far, I optimized using three annealing temperatures of 50, 53, and 55. Among them, 53 give a good peak without any smaller peaks, or etc.
FYI, I used 5x HOT FirePOl Evagreen qPCR Mix Plus (ROX) from Solis BioDyne. The mix composed of HOT FifrePol DNA polymerase, 5x Evagreen qPCR buffer, 12.5mM MgCl2 (1x PCR solution = 2.5mM), dNTPS, Evagreen dye and ROX dye. Following are the final concentrations of Evagreen master mix, primer sets, DNA template per 20ul PCR tube (one reaction):
5x HOT FirePol Evegreen qPCR Mix Plus - 4ul (1x)
Primer forward - 0.5ul (250nM)
Primer reverse - 0.5ul (250nM)
DNA template - 1ul (2.5ng/ul)
H2O PCR grade - 14ul
Following is the qPCR cycles:
Initial denaturation - 95oC, 15min, 1 cycle
Denaturation - 95oC, 15s, 40 cycles
Annealing - 50, 53 or 55, 20s 40 cycles
Elongation - 72oC, 20s
Here attached the melt curves for three annealing temperatures as well as the result of gel electrophoresis. My questions as below:
1) How to clear the non-specific product or dimer-primer based on my qPCR condition or master mix, if relevant?
2) How come there are many bands appeared even though there is a nice melt curve obtained with annealing temperature of 53?
3) Why specific product shows different Tm with different annealing temperatures (please refer to the attachment)?
4) Since there is Evagreen dye included master mix, do I still need to place dye for gel electrophoresis? For this case, I am using gel red\
dye.
Hopefully, you guys could share the great experiences and knowledges with me.
Many thanks
Seng

Your lane 6 result looks very good. The others show bands resulting from the binding of your primers to the wrong location. The melting curve is supposed to look like the one in lane 6. All the others show multiple products (the broad two-peaked bands). You want a narrow sharp peak as in lane 6. Probably this means you could usefully use an even higher annealing temperature.
1) You have mostly nonspecific products, only line 6 has a small dimer. Actually none of your melting curves is nice, though line 6 can be called sufficient. The products on gel look all bad, nonspecific. The product has to be a sharp peak like line 6, if you se somehow wider peak, like in 53 C annealing temperature, it means there are actually two peaks close together. Other curves have distinct second peaks. Line 6 has a small second peak with lower intensity, which is a usual characteristic of a primer-dimer.
Tm calculator in primer3 calculated Tm of your primers to be 60. So I would increase anneling temperatire even further. Basically you should increase the temperature up to the point, where the result will become fainter than temperature before, to know that the last one was optimal temperature.
AND/OR you can try changing MgCl2 concentration (lower in your case, since you have nonspecifities).
3) If you look closer, they don't. In all curves there is a peak about 87, but sometimes it's not the highest one, that means that nonspecifities are amplified more than your specific product.
4) Evagreen should be fluorescent even in gel, but you need to have transluminator compatible with it's excitation wavelength. For example your UV can excite SYBR green used in qPCR so we see it as a green glow while ethidium bromide is reddish.
Best way to try that is to run a gel without dye and see. If you won't see anything, you can stain the gel afterwards with your usual gel stain to make sure there is something to be seen in the first place.
