Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Biology

FLP-FRT recombination - (Sep/03/2012 )

Dear people,

i need someone withe expertise in FLP-FRT recombination. I obtained a strain from the Keio collection and actually learned by sequencing the the strain carries a mutation in one of the FRT sites changing the sequence to GAAGTTCCTATTCTCTAGGAAGTGTAGGAACTTC (instead of GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC).

Does anyone konw if this will dramatically alter the recombination efficiency? ...i need to get rid of the resistance ...if this is not possible i'm in trouble!

Many thanks in advance!

Best regards,
p

-pDNA-


The 34bp long FRT site sequence is : 5'-GAAGTTCCTATTCtctagaaaGTATAGGAACTTC-3'.
Flippase (flp) binds to the 13-bp 5'-GAAGTTCCTATTC-3' and to the reverse complement of 5'-GTATAGGAACTTC-3' (5'-GAAGTTCCTATAC-3').
The FRT site is cleaved just before 5'-tctagaaa-3', the 8bp asymmetric core region, on the top strand and behind this sequence on the bottom strand


As your scenario, middle asymmetric site is till asymmetric with one base change. in second with reverse complement your Flippant need to recognize C instead of T. If everything goes well, I think this way you would be studying both knockout and FRT site behaviour for Flippase recognization.
Of course I do not know answer to your question. you may try procedure you are following if these point mutations are not recognized by Flippase as potential hindrance your things should work fine.

-prabhubct-