Problem with expressing genes using tac promoter - (Apr/03/2012 )
Hello,
I know that there are many experts here, so could any one help me to figure out what kind of trouble I'm having in expressing a gene using tac promoter?
Originally, I successfully overexpressed this gene in BL21(DE3) using T7 promoter and the same RBS (the expression level was high).
Then I wanted to express this gene in MG1655, so I had to change the promoter to Ptac. I did PCR to clone the Ptac + lacO sequence to replace PT7 (in pET16b) as I described in the below sequence. I also calculated the strength of the previous RBS in MG1655 and I got the translation initiation rate of around 57.000 au (it was around 9.000 au in BL21(DE3)). I checked the sequence very carefully, everything seems correct, but I didn't get any expressed band after inducing the cell with 1 mM IPTG (cells grew normally as the control with blank vector).
I did the same thing with the other two genes that I already expressed in BL21(DE3) with PT7 and all of them failed under the control of the new Ptac.
Is that any problem in this sequence, or what should I do to find out the reason of my failure?
AGATCTCGATGACAATTAATCATCGGCTCGTATAATGTGG
Any help will be appreciated, thank you so much in advance.
Looks pretty good to me. the paired GGGG and CCCC sequences look as if they could (especially with the rest of the lacO inverted repeat) make complex structure. Are those part of the normal Ptac site? The promoter "up" region is to the left of your sequence, and has an important role in controlling the promoter strength. Does your vector or strain have lacI constitutively expressed? Even if it does, you may want to overexpress it with a lacIQ style promoter.
Thank you phage434 for your response.
This complementary sequences belong to the original lacO sequence downstream PT7 in pET16b of Novagen, I just changed the promoter sequence. I've found the sequence of Ptac from pTAC-MAT-Tag-2 Expression Vector of Sigma-Aldrich
TTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAC
_____________Ptac_________________________________lacO___________________
The only difference is the lacO they use is the consensus one that lacks the GGGG-CCCC pairs as you mentioned (if not mention an extra T on the 5' end of Ptac).
The vector I use is pET16b, it has all the necessary components for PT7, including a constitutively expressed lacI.
I will clone the Ptac again base on the sequence in pTAC-MAT-Tag-2, but still I can't figure out what is essential here
I would check also the region at -50 to -40 (the "up" region) to compare it to consensus up sequences. I could easily believe that the GGGG --- CCCC surrounding the lacO site would cause some problems.
Yes, thank you. I checked the original paper describing tac promoter and found out that T should be there since it's in the -35 sequence. This might be the reason, not the hairpin, because the GGGG-CCCC pair is in pET16b and I had no problem with T7 promoter and that lacO.
I will inform latter if it works or not.
