How do I insert a DNA sequence into a multiple cloning site and add restriction - (Oct/17/2011 )
I'm are trying to insert the DNA sequence below into the multiple cloning site of a plasmid that has been digested with BamHI (cuts 5’GGATCC3’) and EcoRI (cuts 5’GAATTC3’). Design PCR primers to amplify the sequence highlighted below, and incorporate the appropriate restriction sites. Assume that a 6-nucleotide long sequence will be sufficient for high specificity amplification (in reality, at least 15 nucleotides are required).
5’-5'GATTACGGTAAATGCCGGATTAACCCGGGTTATCAGGCCACGTACAACTGGAGTCC-3’
3’-3'CTAATGCCATTTACGGCCTAATTGGGCCCAATAGTCCGGTGCATGTTGACCTCAGG-5’
u sud also add at least 3-5 more basepairs to 5' end before RE site so that Restriction Enzyme can sit properly over DNA and cut it efficiently..
gd luck
