Tm calculation for primers with RE sites and overhangs - (Sep/18/2011 )

Hi,

I always wonder do we have to calculate the Tm for the whole primer, or only for the sequence complementary to the gene of interest? the TM for the blue regions are 50 and 64C respectively, but for the whole primer are 67 and 72C.



P1-BsmBI:

CAGACGTCTCGTATAGGGACCAAACAGAGAATCTGTGAG (TATA and GGG are introduced)

P2-PmlI

CTTGCACGTGTGCAGCACTCGGGGCGCCTGC
Expected size: 3700 b

My PCR doesn't work. I use pfu.

Only the complementary sequence, as the Tm has to do with only the binding component.

What are your PCR conditions? 3500bp is quite a large product, do you have a long enough extension time?

Thanks Leelee.

According to the manual, the extension time should be 2min/kb. So I had my extension for 8 min. Should be enough.

So I shouldn't worry about the Tm of the whole primer.hm....I had my annealing Temp at 45C

Primer3+ says your first primer (the complementary part) has Tm 45 and the second 78 and both have high self-complementarity on 3' ends. So you have high dimer probability, huge difference in Tm and low Ta (there may be secondary structures in DNA that prevent amplification).
I would recommend primer redesign and higher Ta (or play with DMSO).

I think I'm gonna go with DMSO, I can't afford re-synthesizing the primers.