No Amplification in PCR - (Jun/07/2011 )

Hi All,

I have been trying to perform a PCR on my mini-prep but to no avail.

My desire sequence (S100B gene) is inside a pDONR223 vector. My mini-prep gave me a concentration of approximately 190 ng/ul. I also got a perfect sequence when my sample was sent out for sequencing. I designed my primers according to the sequence with about 10 to 20 bp overhang.

I have tried running a gradient (45C to 65C) PCR but I don't get any bands except for the primer and the vector.

These are the primers:
5’ Primer CAATAGGGATCCCAACTTTGTACAAAAAAGTTGGC
3’ Primer GTAGCAGCCTGAGTCGTTATTAGCCAACTTTGTACAAGAAAGTTGG

Any insight would be greatly appreciated! If you need any additional information please let me know.

Thanks!

How long is your plasmid? How much of the plasmid you put into the PCR? What is the reason for the overhangs on primers?

In 190ng/ul plasmid there is huge amount of your target sequence, sometimes that may inhibit the reaction, dilluting the plasmid then helps. But I'm still not sure it's the case when I look at the primers, did you ever used them succesfully before? What primers were used for sequencing?

If you can see a template band on your pcr gel, you are using WAY too much template DNA. Dilute your template 1000x and try again. Very likely the PCR reaction is being inhibited.

Trof on Wed Jun 8 06:23:45 2011 said:

My plasmid is approximately 3kb. I actually tried diluting my plasmid to about 1ng/ul and 30 ng/ul before placing into the PCR reaction but still no band. The overhangs on the primer is for in-vitro expression. For sequencing I used a different set of primers, they are more upstream of my gene of interest. I have never actually tried using this primer on any other clone. I did perform a control on another vector (pSNAP) and it work fairly well, so I know its not my PCR reagents.

Thanks!

Thanks everyone for your help. I got product after using the Phusion Polymerase and added DMSO.