Protocol Online logo
Top : New Forum Archives (2009-): : PCR, RT-PCR and Real-Time PCR

No Amplification in PCR - (Jun/07/2011 )

Hi All,

I have been trying to perform a PCR on my mini-prep but to no avail.

My desire sequence (S100B gene) is inside a pDONR223 vector. My mini-prep gave me a concentration of approximately 190 ng/ul. I also got a perfect sequence when my sample was sent out for sequencing. I designed my primers according to the sequence with about 10 to 20 bp overhang.

I have tried running a gradient (45C to 65C) PCR but I don't get any bands except for the primer and the vector.

These are the primers:
5 Primer CAATAGGGATCCCAACTTTGTACAAAAAAGTTGGC
3 Primer GTAGCAGCCTGAGTCGTTATTAGCCAACTTTGTACAAGAAAGTTGG

Any insight would be greatly appreciated! If you need any additional information please let me know.

Thanks!

-renee-

How long is your plasmid? How much of the plasmid you put into the PCR? What is the reason for the overhangs on primers?

In 190ng/ul plasmid there is huge amount of your target sequence, sometimes that may inhibit the reaction, dilluting the plasmid then helps. But I'm still not sure it's the case when I look at the primers, did you ever used them succesfully before? What primers were used for sequencing?

-Trof-

If you can see a template band on your pcr gel, you are using WAY too much template DNA. Dilute your template 1000x and try again. Very likely the PCR reaction is being inhibited.

-phage434-

Trof on Wed Jun 8 06:23:45 2011 said:


How long is your plasmid? How much of the plasmid you put into the PCR? What is the reason for the overhangs on primers?

In 190ng/ul plasmid there is huge amount of your target sequence, sometimes that may inhibit the reaction, dilluting the plasmid then helps. But I'm still not sure it's the case when I look at the primers, did you ever used them succesfully before? What primers were used for sequencing?



My plasmid is approximately 3kb. I actually tried diluting my plasmid to about 1ng/ul and 30 ng/ul before placing into the PCR reaction but still no band. The overhangs on the primer is for in-vitro expression. For sequencing I used a different set of primers, they are more upstream of my gene of interest. I have never actually tried using this primer on any other clone. I did perform a control on another vector (pSNAP) and it work fairly well, so I know its not my PCR reagents.

Thanks!

-renee-

Thanks everyone for your help. I got product after using the Phusion Polymerase and added DMSO.

-renee-