Product size? - (May/29/2011 )
Hi,
Please I would like to know what is the product size of my primer?
I have this informations:
Mouce Actin F: gcagctccttcgttgccggt
Mouce Actin R: cccgcccatggtgtccgttc
Please, can somebody explaine how can get it from NCBI (in detail)?
Thanks
Your PCR amplicon should be 135 bp long and here it is:
CCCGCCCATGGTGTCCGTTCTGAGTGATCCTCAGGACCCTGCAGTGAGGTACTAGCCACGAGAGAGCGAAGGCCCGCTGGGCCCGGCGTCCCTGCTTACCTGGTGGCGGGTGTGGACCGGCAACGAAGGAGCTGC
This is how you get this information:
1. BLAST one of your primers against NCBI's database of mouse sequences:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&SHOW_DEFAULTS=on&BLAST_SPEC=OGP__10090__9559
2. Get the first genomic DNA contig in your BLAST results:
http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?maps=blast_set&db=all_contig&na=1&gnl=ref%7CNT_081055.6%7C&gi=149254687&term=149254687%5Bgi%5D&taxid=10090&RID=Y4ZU94R4014&QUERY_NUMBER=1&log$=nuclalign
3. Click on the "Download/ViewSequence/Evidence" link at the top right corner of this page:
http://www.ncbi.nlm.nih.gov/mapview/seq_reg.cgi?taxid=10090&chr=5&from=143618357&to=143718356&QUERY_NUMBER=1&RID=Y4ZU94R4014
4. Click "Display" in the page that loads:
http://www.ncbi.nlm.nih.gov/nuccore/NT_081055.6?from=206606&to=306605&report=fasta
5. At this point what I do is copy and paste the DNA sequence into Microsoft Word and simply search for my primers in the DNA sequence (you first need to remove all blank spaces within your DNA sequence so that it is one continuous DNA sequence). Once you do that you can ask Word to "Word count" the number of nucleotides from the start of your forward primer to the end of your reverse primer. Done!
Hope this help.
Cheers!
Or you can identify a target sequence by BLAST as described and then paste the sequence and the primers to primer3 or PrimerBLAST and the program will tell you length of your product and important features of the primers.
I found that quicker and easier than editing sequence in Word, you can make mistake in editing.
Thanks very much ivanbio and Trof.
Why when I search to find my primers I found the reverse one while with the forwared I found it's complementary, why not vice versa?
I tried to use Trof idea but I didn't work with me I don't know why? Can I have some details on it , please.
When I BLAST your F primer (you need to check Mouse genomic + transcript) the first 100% hit is on mRNA. And it's forward. Underneath are hits on the genomic sequences, which are reverse. That's because genomic sequence is reversed, mRNA has only one correct direction, the way the reading frame goes, but whole chromosome you can read both ways. Nowadays most DNA sequences are complete chromosomes and sometimes the genes are sense, sometimes antisense so this particular gene is antisense.
OK, the fact it's a genomic reverse sequence makes it a bit more dificult. Look at the BLAST results from both primers, look on this respective sequence (NT_081055.6) and look at the Sbjct numbers. Take the lowest and highest numbers from both BLAST results (in this case 256615 and 256481) and get your FASTA sequence as ivanbio wrote till step 4. On the right there is Change region shown, and put those numbers there. Now you got your amplicon. Also on the left is Customize view where you can display reverse complement. Reverse it and put to primer3, that would tell you lenght of the products and other things such as that the Tm of your primers is sky high.
Trof on Mon May 30 08:36:41 2011 said:
When I BLAST your F primer (you need to check Mouse genomic + transcript) the first 100% hit is on mRNA. And it's forward. Underneath are hits on the genomic sequences, which are reverse. That's because genomic sequence is reversed, mRNA has only one correct direction, the way the reading frame goes, but whole chromosome you can read both ways. Nowadays most DNA sequences are complete chromosomes and sometimes the genes are sense, sometimes antisense so this particular gene is antisense.
OK, the fact it's a genomic reverse sequence makes it a bit more dificult. Look at the BLAST results from both primers, look on this respective sequence (NT_081055.6) and look at the Sbjct numbers. Take the lowest and highest numbers from both BLAST results (in this case 256615 and 256481) and get your FASTA sequence as ivanbio wrote till step 4. On the right there is Change region shown, and put those numbers there. Now you got your amplicon. Also on the left is Customize view where you can display reverse complement. Reverse it and put to primer3, that would tell you lenght of the products and other things such as that the Tm of your primers is sky high.
Tanks Trof,
When I copied the reverse coplement in primer3, the left and right primers were not match with any of my primers. So, how I can sure what I'm did is right?
What options I need to change in primer3?
Thanks
If I got what is your problem, you need to copy the reverse complement AND your primer sequences there (to the Pick left primer, or use left primer below and Pick right primer, or use right primer below fields). If you leave the primer fields blank it will try to design a new pair of primers.
I tried it and it worked, I didn't change any options.
Trof on Mon May 30 13:40:13 2011 said:
If I got what is your problem, you need to copy the reverse complement AND your primer sequences there (to the Pick left primer, or use left primer below and Pick right primer, or use right primer below fields). If you leave the primer fields blank it will try to design a new pair of primers.
I tried it and it worked, I didn't change any options.
Yyyyes, many thanks for you.
Finally, how I know I'm going to amplify single copy not multiple copy genes?
Cheers
