Protocol Online logo
Top : New Forum Archives (2009-): : DNA Methylation and Epigenetics

Problems designing primers for BSP - (May/02/2011 )

Hi, I'm new in the field and am trying to design some primers to check DNA methylation in the promoter region, I tried methprimer and gave me some primers, but when checking them in Primer3 it says the right primer is unacceptable.

Could anybody please help? Also I can see two CpG islands, but the software only gave primers for one.
My sequence is:
TGCTCTGTGGTGCTGGGGACCTGGCTTTAGTTCCTCGGGGGTGGAGGGGGCACCGCGCT
GCCTGCCTCCGAGCTGTCTGGAGCAGCCAGTCCTGCAGATGTGGGCAGCTCAGGGCCCGT
GGGAGGGAGGGGGCTTTGTGCCCAGGGCAGCAGCTGAAGGAGCCCCGGGCCTCGCAGCCC
CTCCTGGGTGACCAGGTGCTGCTTCGTGGCAGCTGCCCCCTCCCGTCCAGCGGGTATGGG
CCCTGCTCCCCCGTGGTGGGGGCGGCGCAGGAGAGTGGAGCGACCCTCATCTAAGTTACC
TCTACCCGGGTCTGAGCCCCCGGACAGACACCCCCGCCCCGACCTGGTTACAGCGCCCTT
CCCCGGTTCGGTCTCCGGTGTGCGCATGTGGGGTGCCCCATGGGCGGCCGCGGTGGGAGC
TGGGGTGGCCATGCGCGCCCCCGCCCCGCCGTCCACCCGCGACTCCAGGTCTGGATCTAC
TCGCCCTCCCCACCCTTTCCCGCCCCCAGCCCCGGAGCCGCGCTCTCACCCCAGGGGCGG
CAAGGGCGATGGACGCGGAGGAAGCGCCCTCTCCCCCTCGGGGGTCTCCCGGAGGCGAGT
CCCGAAGGGGGCGAACTCCGAAGTGGGTCCCGGGTGGGAGGCGCGCGGCCCCGCCCGGCG
GGGAGGGGGAAGCGGCGGAGGCGGGTGCTCAGCGGCGCCCCTGGCGGCGGCCGGCGCAGG
TGCAGGTCCCGGAGGAGGCTCCGCCCGCAGCCCAGACCCCCGCGGGGTGGGCGGGACGCG
GACCCTGAGACCCGCAGCGCCGGACCCGGACGGGAGCCCCTCTCCTCCCCCTCGGGCACG
TCCCCGGCCGAGCCTTCCCGCCCTCCTCTGGGGCTCCCACCTCCCCTTCACCCGCGGGGG
ACCCGATTTCCGCGTCTCCTGGGCCCCTCCCTGGGCAGGGGGTCCAGCCGGAATCCAGGA
GTGACCTGCTGGAGGACTTGGTGGCCAGGGAGTCACCCTGGGAGCCCGGTCCTGTGACCC
CTTAATGGATTCTCTGCGCTCCTGGGCGGGCCCCTTGGTCGCATCGGGGCAGGGGAATCG
CAATAAGGAAAGTGTAATTCACGCAGAGCCGGCTGCGGGGGAGACGGGAGTTTTATTATT
ACTCAAATCCTTCTCCCCAAAAACGTGGGGATCCGAGTTTCGAAGGATGATATGGTGGGT
AGGCGGCCAGTGAGTCAGGAGCGCTGACCGGTCCGGTTGGAGATGAAGTCTTGGGGAGTC
GAAGCTGTCTTCCCAACCCTAACCCAGCTCCTCGGTGGGGGCCACAGGACCACATGAGCA
AGATTGTGGATTTAGGTGGTGCCAGCTGATCCATTGAGTACAGGGTCTGTAAAGTATCTC
AAACTCTGATCCTAGGTTCTACAGTAGTGCTGTGATCCCCGGGAGCAATTTAGGGGTGGC
GGGGTCAGAATCTTGCATCCTCCAGCCGCGTGACTCCTAAACCATAATTTCTAATCTTGT
GGCTAATTTGTTAGTCCTGCAAAGGCAGTCTGGTCCTCAGGTAGGAAGGGGGCTTGTTCA
GCCTTGATCTATAAACTGTTTCTCTCCAGATTAGTTTAGGCTAAGCCCAGGGATGAGCAA
GGGCAGCTTGGAGGTTAGAAGCCAGGCGGAGTGGGTTAGGGTCAGACCTCCTTCACTGTC
ATCATATTCTCAGTTATGACTTTTGCAAAGGTGGTTTCAGTTCCATGCCTGCCCCTCAGA
ATCCTGTCTCCCTCTTGTGCCCTGCAGTTTCTTCCTTCCTAAACTGCCCGTGATTTAAAG
AAGCTTCCAAAATACCTTCCACGGGAAATTCAAGCCCCACCCCACTCCGCAGTGATGTGT
GGCCTTTGATAGGAGGTCACAGAGCCTTGTGAGGAGTTTGTGTAGGCAGTCCTCGATGTC
TCAGAGCACGCTCCATCCACATCCACCCCTGGCTTGCCGGGACCCAGACATAGTTTGGTC
TAAGTGGCCTGGGATGTGGCTGGGGCTGGAGGCGGCCTGTTGAGGGGTGGGTGGAGGGTG
GGGGGGTTGGTGTGCGATTTGGGGAGGCCCAGCAGGGACTCCAAGCAAGGGCAAGGGCTA
GTTCTTTTTTTTTTTTTTTAGCTGCAATGGGTAGGGAGGGGCTGATGGTTTTGGAGCTCG
GTGTTTGAGATGTTAAGTCTGCTGATGCTCCTGGCCGAATAAAGGCCAAATAAAGCCCTT
TCTTTCCTCAACTCGATGTCTGAGGGTTTTGTCTGTGGCTCGTCCTGCTACAATTTCTAA
CGTTACCAGTAATTTTAAAGCTAGCTTATTAAAGATTCTACTTAAGTCACATGAACGTGA
AAAGCATTTAGGCTTATTATTTAATTTATGAGTACTCTTTAAGTTTAAGCTAAATTTGGT
AACTTGTGGCCAAAAACACATAACGAAATATGTGTATGTGCACATATACACACATACACA
CTCAAGCAAAAGTATGGTTTTACTTCAGAACTCCAGCCATGAGATAGTAATACAAATTCA
TTGGTTTACACAAACAATAAAAAGAAATGGTTGGATGCAAACAGTGGATTTTATCTCTGT
AGAAAAGTAACAGCAGACTTAAAGCAGGCAGAAACGAAAGCAGAAAGAGAACTTAAGAAC
ATTACATTAATAATTGCAGGCCCACCTTTGGGCTCTGATTTTTCCTTTATGTAATTTGCA
ATTTGTAATTCATGATCCTTGTGCCTGAGGGCTCCCTTCTGCTACTCAGTCTACAATTCC
CCGTCCCTGTGAAGGGGCACCCAGGCCTGACAGCCCCAGACTTGGCTTTGCCAACCCTCC
AGGTCTCTCCTGCATGGCTAGGACCCAACGCCTAGGTCATCCAGCACTCACCCCAACCAA
AGCCATGGGAATTGCTGGGACCCGGAAGGTAGGGGGTGGCACATGTGTGCCCTGTGCTCT
GAAGCTGCCCCTACAGGCCCTGGAATCCTCCCCGTGTCTCAACACACTACCCTCTGGGG

Thank you!!

Elena.

-EHMehtyl-

Most primers designed on bisulfite modified sequences do not meet the quality standards of standard PCR primers because the modification significantly reduces DNA complexity and makes the sequences unsuitable for picking primer sites.

If you just want to study one of the CpG islands, you can just use part of the sequence containing that island and try again instead of using the whole sequence.

-pcrman-

Ok, I'll do that. Thanks!! And I'll order my primers and see how they work...

-EHMehtyl-