Primer dimer formation and real-time PCR - (Apr/29/2011 )
Dear all, my simple question is: Can we use primers, which form dimers for real time-PCR?
I tried everything, even re-designed the primers - nothing works. In one of the topics here I met the following link: http://www3.appliedbiosystems.com/WebTroubleshooting/NTCPositiveAmplification/Primer_dimer_formation.htm.
In my view, if we do not have contamination of sample and non-specific amplification, the dimers could be easily distinguished and we can use only the information provided by the main peak - am I right?
With many thanks,
Nephrite
The link isn't working for me (Not Found), so I don't know what are you referencing.
What dimers are you talking about, dimers present in your sample or the "non-template" dimers that sometimes form only in negative control? If you are trying to quantify your template with SYBR you shouldn't have any dimers in your sample, because you can't distinguish which part of signal is comming from dimers and which from your desired amplicon. You can't compare your samples.
Trof on Fri Apr 29 11:38:03 2011 said:
The link isn't working for me (Not Found), so I don't know what are you referencing.
What dimers are you talking about, dimers present in your sample or the "non-template" dimers that sometimes form only in negative control? If you are trying to quantify your template with SYBR you shouldn't have any dimers in your sample, because you can't distinguish which part of signal is comming from dimers and which from your desired amplicon. You can't compare your samples.
Thank you very much for your reply.
Here is the link again - maybe this time it would work. It is posted by user dnafactory in regard of the pinned topic Primer dimer issue in real time PCR.
Yes, two of my primer pairs form cross-dimers in positive samples and also in NTC. I can`t get rid of them. Really nothing would help?
I see, there is a dot at the end of your link, which I didn't noticed first, without it it works fine.
Well if you have dimers in sample reactions you must get rid of them, there is no way how to quantify only one peak from two using SYBR. You said you did the primer concentration optimization as mentioned in the ABI note and you did try to design new primers and still have the dimers.
You have to design primers that wouldn't form dimers, what application/settings do you use for primer design? Do you have a picture of a melting curve with dimers? What are your primer sequences?
I suspect that also bad synthesis quality of primers can contribute to primerdimer formation. maybe you try a different oligo supplier.
Trof on Fri Apr 29 12:51:59 2011 said:
I see, there is a dot at the end of your link, which I didn't noticed first, without it it works fine.
Well if you have dimers in sample reactions you must get rid of them, there is no way how to quantify only one peak from two using SYBR. You said you did the primer concentration optimization as mentioned in the ABI note and you did try to design new primers and still have the dimers.
You have to design primers that wouldn't form dimers, what application/settings do you use for primer design? Do you have a picture of a melting curve with dimers? What are your primer sequences?
Thank you for helping me.
I still haven`t started with the real-time. I see the crossdimers (app 50 bp) on my gels and tried combinations of everything what I read here and in manuals to get rid of them. I have this problem only with two of the genes I want to explore. For the design I used Primer-3-Plus, and then - Premiere BioSoft to check for secondaries and interactions.
If you are interested, here are my sequences:
NM_012019:
Pair 1:
R - ccacaccaccgttctcaata
F - ccatacatgcgacctcctct
No hairpins, 1 F dimer (not visible on gel), no cross-dimers (according to the Premiere BioSoft). In fact, this pair makes the stongest cross-dimer.
Pair 2:
R - agaggaggtcgcatgtatgg
F - gattggtggagggactgct
No hairpins, 2 R dimers (not visible on gel), 1 cross-dimer.
NM_010431
Pair 1:
R - aaaaagctccgctgtgtgtt
F - tgagatgaaggcacagatgg
No hairpins, one R and one F dimers (not visible on the gel), 3 cross-dimers. In fact, this pair makes the slightest cross-dimer - almost invisible, but still there.
Pair 2:
R - agtgaagcaccttccacgtt
F - aacacacagcggagcttttt
No hairpins, three R and one F dimers (not visible on the gel), 2 cross-dimers.
The pairs for the other genes should make even more cross-dimers in theory, but nothing on gel. All primers were loaded with NTC only in order R only, F only, RF.
Well, I did some progress when increased the template amount up to 100 times more, but this is not a solution.......on the contrary, dilution of primers hasn`t got effect - they still cross-react, but do not amplify.
tea-test on Fri Apr 29 13:58:32 2011 said:
I suspect that also bad synthesis quality of primers can contribute to primerdimer formation. maybe you try a different oligo supplier.
Thank you for replaying me.
There were supplied by Sigma - well, I also thought a similar thing, but my colleagues here said that I am the only one case :-/
I just had a quick look on the first two pair of primers and they both look fine for me in primer3 (the first forward primer has unacceptable similarity to rodent mispriming library though, according to primer3). I just noticed they were designed to a complementary strand to mRNA, for what reason?
I personaly wouldn't play with gel but run it on real-time, it's a different cycler, different chemistry, I never found it to be much usefull to try to optimize real-time primers on classic cycler. Run a sample or better a dilution curve and non-template control and then you will see if you have dimers to care about. You can post a picture if you do.
