Colony PCR doesn't work anymore - (Apr/23/2011 )
Hi,
If have difficulties in testing positive clones via colony PCR.
Context: I did a LR Gateway reaction between an Entry Vector and three different Destination vectors.
Result should be 3 different Expression vectors with the same gene insert each.
I did this with 2 gene inserts which should have the same sequences.
let's call them
1)
Expr_1_A
Expr_1_B
Expr_1_C
2)
Expr_2_A
Expr_2_B
Expr_2_C
Then I transformed these vectors into E.coli and grow them on selection plates. Because of the antibiotic resistance plus
the ccdB gene on the destination vector there is a double selection for positive clones there should be a high chance getting
positive ones.
After 1 night incubation on 37°C I picked single colonies and did a colony PCR to verify positive clones.
Therefore I first tested
1)
Expr_1_A
Expr_1_B
Expr_1_C
with 3 colonies for each vector (= 9 PCR reactions)
8 out of nine tested positive.
Meanwhile I got the results from entry clone sequencing: Base exchanges in the gene insert.
So I transformed my backup (sequence of the entry clone before LR reaction seems to be correct):
2)
Expr_2_A
Expr_2_B
Expr_2_C
I ran the same colony PCR procedure:
NO positive clone.
I repeated PCR, picked new clones, repeated LR reaction and transformation, but I never got positive
results of the colony PCR anymore...
Maybe there is a mistake in my procedure???
PROCEDURE:
a) get single colonies
1) Pick single colony from plate with a pipette tip
2) scratch pipette tip in a 1,5 ml reaction tube containing 10 µl water
3) mix by pipetting
b ) prepare master mix
32.5 µl dH2O
5.0 µl Buffer
1.0 µl dNTPs 10 mM
5.0 µl forward Primer 5 µM
5.0 µl reverse Primer 5 µM
0.5 µl Taq Polymerase
∑ 49 µl
c) Put mastermix in PCR tubes and add 1 µl of the bacteria suspension to each tube
d) run PCR
1) 3 min 94 °C
2) 30 sec 94 °C
3) 30 sec 47 °C
4) 1:45 min 72 °C
5) 6 min 72 °C
6) ∞ 4 °C
Steps 2-4 are repeated 35 times
Primer sequences:
ACAAGTTTGTACAAAAAAGCAGGCT
CCAACTTTGTACAAGAAAGCTGGGT
Length of the section to be amplified = 1403 bp
Maybe someone can support me with some ideas and improvements...
I would dilute the colony in 50 ul of water, not 10 ul. I would use 0.5 ul in the pcr mix. Neither of these are likely the problem. The cycling conditions seem strange. I would do 55C anneal (not 47) and a longer extension (1.5 minutes). The initial denature time for colony pcr also seems shorter than I would use, and too low in temperature. I'd do 96/5 minutes and denature during the cycling at 95. The two primers are very similar. I would expect mispriming, especially if there are other sequences similar to these on the template.
phage434 on Sat Apr 23 19:38:02 2011 said:
I would dilute the colony in 50 ul of water, not 10 ul. I would use 0.5 ul in the pcr mix. Neither of these are likely the problem. The cycling conditions seem strange. I would do 55C anneal (not 47) and a longer extension (1.5 minutes). The initial denature time for colony pcr also seems shorter than I would use, and too low in temperature. I'd do 96/5 minutes and denature during the cycling at 95. The two primers are very similar. I would expect mispriming, especially if there are other sequences similar to these on the template.
Thank you for the fast answer!
Ok so you think the concentration of bacteria in the PCR mix is to high? I'll try your dilution suggestion.
1.5 minutes: Do you mean 1:30 min (90 sec) or 1:50 min (110 sec)? Because you are talking of a longer extension I would assume you mean
1:50 min.
You are right, there seems to be a high amount of primer dimers...these are attL Primers (attL1 forward and attL2 reverse).
Sorry, I misread your protocol the first time, and thought it was 45 seconds. I meant 90 seconds, but 105 seconds is fine.
You won't get primer dimers from those primers, since they are nearly identical. You may get priming of one sequence by the opposite primer (if that matters to you).
You should always run some positive control pcr (since I think you have some colonies that gave positive responses). You might also want to use one primer binding to your insert and another binding to the vector. This can establish insert direction, and also eliminates problems from carryover insert DNA on the transformation plate.
Sounds convincingly. My plan for tuesday is to use an other reverse primer: The reverse primer that I used to amplify my insert gene.
My expression clones are the result from a directional incorporation of the amplified insert gene (leading CACC sequence on my forward primer
that is not binding) into a Topo-Vector. My Expression clones are the result from a LR reaction between this TOPO-Entry Clone with a Destination
vector.
