Question about TM and Annealing temperatures - (Apr/23/2011 )
Hi,
I designed several primers for a directional TOPO-reaction.
But not all of them are working...Can you give me some tips how to determine
a good annealing temperature (except for gradient pcr)?
For example these to primers
a) CACCATGGAGATCCCGGTTCGA (22 bp TM = 53.4)
b ) AGTTGCTATTTTTTCTAATTTCTC (24 bp; TM = 46.8)
The TMs are calculated via Vector NTI. In case a) the leading CACC sequence is ignored
for the calculation because it is not really binding.
As a rough rule of thumb the annealing temperature lies 5°C below the TM. In this case it would
be 41.8 °C. A little bit low, isn't it?
Essentially no pcr reactions work with annealing below about 50 C. Try 55C annealing temperature, it will probably work. If not, try 52 or 50. I think those primers should work at 55.
phage434 on Sat Apr 23 18:21:46 2011 said:
Essentially no pcr reactions work with annealing below about 50 C. Try 55C annealing temperature, it will probably work. If not, try 52 or 50. I think those primers should work at 55.
Ok thank you. I will try it on tuesday!
Hm, but it's quite strange that the program predicts such low Tm values...
Why do you think that they should work at 55?
Your low Tm, particularly for your second primer, is due to the very high proportion of Ts. Primer programs are not fool-proof, and will always try to design primers to the region you provide them, which may not be the ideal region for PCR. If possible I would do the following:
1. look for another region to design your primers, especially primer 2
2. I would increase the Tm of your primers (make them longer) to take into account the CACC tail you are adding that does not bind. Primer binding stability will be lower when you have a single stranded tail floating around. Some 4 to 8oC for these 4 nucleotides would suffice.
Good luck
Unfortunately I cannot avoid these T-rich regions. My primers must include these sequences because I want to amplify a coding sequence of a gene to assemble an expression clone.
The only possibility might be to make some longer primers that should have a higher TM.
