Deep sequencing adaptor question - (Apr/11/2011 )
Hello, I will be going through a deep sequencing protocol soon and it lists a series of adapters to use. The 3' adapter has the sequence 5′ AppTCGTATGCCGTCTTCTGCTTGidT 3′ and is called a 3' adenylated adapter. What does the App stand for? What is the GidT at the 3' end? That doesn't look like an adenine to me.
Thank you
-mcb56-
To add to my question, why does the 3' linker need to be adenylated? I am using T4 RNA ligase to add this linker to my RNA fragments.
Thank you
-mcb56-
