Sense and antisense DNA, and primer design - (Jan/14/2011 )
Hellow, everybody.
I`m trying to understand the philosophy of primer-design for RT-PCR. Here I read some very useful posts (many thanks!), but still have few general questions:
1. template DNA means the antisense, non-coding strand, which is complementary to the sense mRNA transcript that is translated into protein;
2. non-template DNA means the sense, coding strand, which does not code RNA but is like mirror image of the mRNA transcript. And this is the published sequence in the databases. It gives antisense RNA transcript, which is not translated into protein;
3. if this is correct, complementary to the sense DNA will be the reverse, downstream, or anti-sense primer;
4. in parallel, complementary to the anti-sense DNA will be the forward, upstream, or sense primer.
Is that correct?
Thank you.
1) actually the template strand is equivalent to the sense (coding) strand on the DNA... which is then turned into RNA... from which you then make cDNA
Like this:
DNA: ATGATGATG
RNA: UACUACUAC
cDNA: ATGATGATG
2)See above... it is the coding strand you are talking about!
3)The forward primer is the same as the 5'-3' sequence of the cDNA.
4) reverse primer is the reverse complement of the cDNA!
i.e. you have it all completely around the wrong way.
bob1 on Sun Jan 16 02:23:58 2011 said:
1) actually the template strand is equivalent to the sense (coding) strand on the DNA... which is then turned into RNA... from which you then make cDNA
Like this:
DNA: ATGATGATG
RNA: UACUACUAC
cDNA: ATGATGATG2)See above... it is the coding strand you are talking about!
3)The forward primer is the same as the 5'-3' sequence of the cDNA.
4) reverse primer is the reverse complement of the cDNA!
i.e. you have it all completely around the wrong way.
Thank you, Bob1!
Hi,
In context to PCR primer design, the template DNA is the region of interest where you would like to design primers. It may be a sense strand or an antisense strand.
However, many a times, in case of expression studies, researchers take the coding strand as a template sequence.
More about these concepts can be found here:
http://thunder.biosci.umbc.edu/classes/biol414/spring2007/index.php/Primers
I would like to mention an excellent tool for designing real time PCR primers: Beacon Designer. It is quite convenient to use and provides specific and efficient primers for real time PCR assays.
Visit: http://premierbiosoft.com/molecular_beacons/index.html
Cheers
Wilson ![]()
Based on the guidelines given in this thread, I've tried to construct sense and antisense primers, could someone please tell me if this is right or not, and if not how to do it right. Thanks in advance.
I have the following ORF:
5' ATGGCGATGATGATGACTGGCCGTGTGCTGCCGGTGTGTGCCCTCTGCGTGCTGTGCTGCGGTTTGTTGTCGGCCGATGCCGGGGATGATGATGTTTCTGGTGATCATGGAACTTTAGGCGGAAGTGGAGTTGGGGCTGATGGTAGACCTTCAGTCCCGGTTGGTAGTGATGTATCCACTGGAGGTACAAAAGATGAATGTTCTCTGGGAAGTGGAGGTGGCTCTCCGGTTTCTGCTTCTACTCCTTGCAAATCTTTACTTTCTGATGCGGAAAATCCGGGGGGTGAGGTTTTCAATGACAACAAGAAAGGATTATCCCGCGTTGAAGGGAACTCCAATGTTGAGCAGGATCCGCCACAGCCAGGGTCTCACGTTGTATCGACAGCCGAGGTGCTAGCACCAGGACAATCCAATTCTGAGGCGCAAGAGCAGTCGTCCGGTAAACTAAGAACAGAAGAGGGGCGTAATAACGGTGATGGCGGCACAACTGTGAAAGAAGAAGTGACTGGCGTGAAGAGTAGAGACACTGCTGACCTGTCCCCTAACGACAGCCGCCCGCCAAAAGCAGCACGACCAGTGACGGGGGAAGAGAAAGGCACAGAGAAACAGGCAGCATCAAAGGCGTCATTAACGCCAGAAGAGGAACGAGGGACATCTGCTGCGACGGATCAAAAAGTTGACTTACCGAAGGAGGAAGCCGCGTCCAGCGCAGGTGCCACAAAAAATCGATCACCTGTCGGTCAACAACAAACAGAAGCTTCATCTCCCTCTACGAGTGGAAGTACTTCGACTCTGACTCCGCAAAAGGAACCCGCTGAGGAGCTCCATTCCAACAATAACCAACCACCTGGTGACGCAGCACCGACAGAAGGAACGCAACATGAAACTCTTCCTGGCGACAAAACGCAAACAGAACCAGCAACTACAAACAACAAACCGATTGACGCAACTCCAACTGGCGACAGTGAGAGCAGCCCCACGGCTCCTCCCGCCGGAGAGTCAGACGCCGCCACAACCACAACCACGAACAATCATGATCCGCGTAGCCTCAACAACAATGGCAACAATACATTCACAGAAGAAGTGGATCAGAAGGAAGCAACAAGAAAACCCAAAAACGCACCAGAAAGCACTGACACTGCAGCAGCCAACAGTGAAGCATCCGCAACAGCCATAAACATCTCCACTAACACAACAAACAAAACAACCACCGGCGACAGCAGCACCGCGGTCTCCCACACCACCTCCCCTCTTTCGCTTCTTCTTGTTGTTGCGTGTGCGGCTGCGGTGGTGGCCGCGTGA 3'
(I know it's not code but without tags it just runs off the screen)
5’ ATGGCGATGATGATGACTGGCCGTGTGCTGCCGGTGTGTGCCCTCTGCGTGCTGTGCTGCGGTTTGTTGTC... and so on
Is this (above) the sense primer?
5’ TCACGCGGCCACCACCGCAGCCGCACACGCAACAACAAGAAGAAGCGAAAGAGGGGAGGTGGTGTGGGAGA... and so on
Is the above the antisense primer? Also, do I have the 5' and 3' right on both of them?
Your primers are correct. The 5'-3' is fine, as is your use of sense and antisense. Usually the primer is only 15-30 bp in length though.
There are any number of programs that will take a sequence and design primers for you, or reverse complement the sequence you have so you can choose a primer. Primer3 is a commonly used web based one. There are also lots of freeware and sharewares out there. I use ApE (A plasmid editor).
Thank you, I appreciate it.
